[BioC] help for mRNA decay rate

[Robert Castelo]

hi Alberto,

at this point i think your question is rather more directly related to
the molecular biology of the cell and the regulatory mechanisms behind
transcription and translation, than to a specific calculation you want
to do. in this respect, unfortunately, i cannot offer you any further
advice.

cheers,
robert.

On Wed, 2010-02-17 at 10:29 +0100, Alberto Goldoni wrote:
> Dear All, first of all thanks for your help.
> 
> For Robert:
> what i would like to know is if the amount of the mutations
> (1,2,3,4,.... many mutations for example) are enouth block the
> transcription process (and so we will have the mRNA decay), or may
> still encode.
> Best regards.
> 
> 2010/2/17 Robert Castelo <robert.castelo at upf.edu>:
> > hi,
> >
> > from the words "will codify" i understand you mean whether the mutations
> > introduce one or more stop codons in-frame so that the non-sense
> > mediated decay pathway would in principle degrade that mRNA. then, if
> > the goal is simply to see whether you have one of those stop codons
> > in-frame you may use the package Biostrings, run the following example:
> >
> >
> > library(Biostrings)
> >
> > codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA"
> > codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT"
> > mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame))
> > translated_mRNA <- as.character(translate(mRNAwithStop))
> >
> > if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) {
> >  cat("stop codon in-frame!\n")
> > } else {
> >  cat("no stop codon in-frame!\n")
> > }
> >
> >
> > if your coding DNA includes the corresponding stop codon at the end of
> > the coding sequence you would have to adapt this code to avoid detecting
> > that "proper" stop codon as being in-frame.
> >
> > here is my session information:
> >
> > sessionInfo()
> > R version 2.10.0 (2009-10-26)
> > x86_64-unknown-linux-gnu
> >
> > locale:
> > [1] C
> >
> > attached base packages:
> > [1] stats     graphics  grDevices utils     datasets  methods
> > base
> >
> > other attached packages:
> > [1] Biostrings_2.14.8 IRanges_1.4.9
> >
> > loaded via a namespace (and not attached):
> > [1] Biobase_2.6.0
> >
> > cheers,
> > robert.
> >
> > On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote:
> >> Dear all,
> >> i have a specific question, if i have a sequence of mRNA with some
> >> mutations, there is a tool in R that can tell me if the mRNA will
> >> codify or will transform in "mRNA decay"?
> >>
> >> Best regards and thanks to all.
> >>
> >
> >
> 
> 
>