[BioC] help for mRNA decay rate

[Alberto Goldoni]

Dear All, first of all thanks for your help.

For Robert:
what i would like to know is if the amount of the mutations
(1,2,3,4,.... many mutations for example) are enouth block the
transcription process (and so we will have the mRNA decay), or may
still encode.
Best regards.

2010/2/17 Robert Castelo <robert.castelo at upf.edu>:
> hi,
>
> from the words "will codify" i understand you mean whether the mutations
> introduce one or more stop codons in-frame so that the non-sense
> mediated decay pathway would in principle degrade that mRNA. then, if
> the goal is simply to see whether you have one of those stop codons
> in-frame you may use the package Biostrings, run the following example:
>
>
> library(Biostrings)
>
> codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA"
> codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT"
> mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame))
> translated_mRNA <- as.character(translate(mRNAwithStop))
>
> if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) {
>  cat("stop codon in-frame!\n")
> } else {
>  cat("no stop codon in-frame!\n")
> }
>
>
> if your coding DNA includes the corresponding stop codon at the end of
> the coding sequence you would have to adapt this code to avoid detecting
> that "proper" stop codon as being in-frame.
>
> here is my session information:
>
> sessionInfo()
> R version 2.10.0 (2009-10-26)
> x86_64-unknown-linux-gnu
>
> locale:
> [1] C
>
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods
> base
>
> other attached packages:
> [1] Biostrings_2.14.8 IRanges_1.4.9
>
> loaded via a namespace (and not attached):
> [1] Biobase_2.6.0
>
> cheers,
> robert.
>
> On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote:
>> Dear all,
>> i have a specific question, if i have a sequence of mRNA with some
>> mutations, there is a tool in R that can tell me if the mRNA will
>> codify or will transform in "mRNA decay"?
>>
>> Best regards and thanks to all.
>>
>
>



-- 
-----------------------------------------------------
Dr. Alberto Goldoni
Bologna, Italy