[BioC] help for mRNA decay rate

[Robert Castelo]

hi,

from the words "will codify" i understand you mean whether the mutations
introduce one or more stop codons in-frame so that the non-sense
mediated decay pathway would in principle degrade that mRNA. then, if
the goal is simply to see whether you have one of those stop codons
in-frame you may use the package Biostrings, run the following example:


library(Biostrings)

codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA"
codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT"
mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame))
translated_mRNA <- as.character(translate(mRNAwithStop))

if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) {
  cat("stop codon in-frame!\n")
} else {
  cat("no stop codon in-frame!\n")
}


if your coding DNA includes the corresponding stop codon at the end of
the coding sequence you would have to adapt this code to avoid detecting
that "proper" stop codon as being in-frame.

here is my session information:

sessionInfo()
R version 2.10.0 (2009-10-26) 
x86_64-unknown-linux-gnu 

locale:
[1] C

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods
base     

other attached packages:
[1] Biostrings_2.14.8 IRanges_1.4.9    

loaded via a namespace (and not attached):
[1] Biobase_2.6.0

cheers,
robert.

On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote:
> Dear all,
> i have a specific question, if i have a sequence of mRNA with some
> mutations, there is a tool in R that can tell me if the mRNA will
> codify or will transform in "mRNA decay"?
> 
> Best regards and thanks to all.
>