[BioC] gcrma error? - linked to makeProbePackage ?

[Benoit Ballester]

James W. MacDonald wrote:
> Hi Ben,
> 
> Benoit Ballester wrote:
>> Hi,
>>
>> I am trying to use gcrma for the mouse GNF/Novartis data.
>> This dataset use a custom affy chip gnGNF1Musa. I got the CDF file and 
>> probe file from GEO.
>>
>>
>>  > library("gngnf1musacdf")
>>  > library("gngnf1musaprobe")
>>  > eset.gcrma<-gcrma(Data)
>> Adjusting for optical effect.......[more dots].....Done.
>> Computing affinitiesError: length(prlen) == 1 is not TRUE
> 
> This indicates that you have probes of more than one length (e.g., they 
> are not all 25-mers). This might have to do with what you note below, 
> that there is an extra column in your probe_tab file. However, there is 
> error checking in makeProbePackage that is supposed to catch these sorts 
> of things, so I am wondering how you were ever able to make the package 
> in the first place.

This is what I get when I install gngnf1musaprobe
  > R CMD INSTALL gngnf1musaprobe
* Installing *source* package 'gngnf1musaprobe' ...
** R
** data
** help
  >>> Building/Updating help pages for package 'gngnf1musaprobe'
      Formats: text html latex example
   gngnf1musaprobe                   text    html    latex   example
** building package indices ...
* DONE (gngnf1musaprobe)

looks fine to me

> What do you get from
> 
> head(as.data.frame(gngnf1musaprobe))

This is what I get :

 > library(gngnf1musaprobe)
 > head(as.data.frame(gngnf1musaprobe))
[1] sequence                     x
[3] y                            Probe.Set.Name
[5] Probe.Interrogation.Position Target.Strandedness
<0 rows> (or 0-length row.names)
 >
 > gngnf1musaprobe
Object of class probetable data.frame with 0 rows and 6 columns
 >
 > gngnf1musaprobe[1,1]
[1] NA

This doesn't look right ?!?

> Does the probe sequence column actually contain probe sequences? If not, 
> you will need to remove the extra column from your probe_tab file and 
> re-run makeProbePackage.




> 
> Best,
> 
> Jim
> 
> 
> 
> 
>>
>>
>> I create the CDF package like this:
>>  > library(makecdfenv)
>>  > make.cdf.package("gnGNF1Musa.cdf", species = "Mus_musculus")
>> then $> R CMD INSTALL gngnf1musacdf
>>
>>
>>
>> When I create the probe package, I have a warning. I don't know if 
>> it's linked to the gcrma error have.
>>
>>  >  filename<-system.file("extdata","gnGNF1Musa.probe.tab")
>>  >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>>  >  species<-"Mus_musculus"
>>  >  outdir<-tempdir()
>>  >  makeProbePackage("gnGNF1Musa", datafile = filename, outdir = 
>> outdir, maintainer = me, species = species, version = "0.0.1",force = 
>> TRUE)
>> Importing the data.
>> Creating package in /tmp/RtmpIaiUst/gngnf1musaprobe
>> Writing the data.
>> Checking the package.
>> Building the package.
>> [1] "gngnf1musaprobe"
>> Warning message:
>> file("") only supports open = "w+" and open = "w+b": using the former
>>  >
>> then $> R CMD INSTALL gngnf1musaprobe
>>
>>
>>
>> I use R Version 2.3.1 (2006-06-01)
>>  > sessionInfo()
>> Version 2.3.1 (2006-06-01)
>> x86_64-unknown-linux-gnu
>>
>> attached base packages:
>> [1] "tools"     "methods"   "stats"     "graphics"  "grDevices" "utils"
>> [7] "datasets"  "base"
>>
>> other attached packages:
>>        gcrma matchprobes  makecdfenv        affy      affyio     Biobase
>>      "2.4.1"     "1.4.0"    "1.10.0"    "1.10.0"     "1.0.0"    "1.10.0"
>>
>>
>>
>>
>> Do you think that the error I get from gcrma is linked to the 
>> cdf/probe package I have made. I also noticed that the probe file I 
>> have, has one extra column called "Serial Order". Do you think it 
>> might explain the gcrma error ?
>>
>> Probe Set Name  Serial Order    Probe X Probe Y Probe Interrogation 
>> Position    Probe Sequence  Target Strandedness
>> AFFX-18SRNAMur/X00686_3_at      1       256     597     1333 
>> GGTGGTGGTGCATGGCCGTTCTTAG       Antisense
>> AFFX-18SRNAMur/X00686_3_at      2       71      547     1341 
>> TGCATGGCCGTTCTTAGTTGGTGGA       Antisense
>>
>> Thanks,
>>
>> Ben
>>
>>
> 
> 

-- 
Benoit Ballester, PhD
Ensembl Team
European Bioinformatics Institute (EMBL-EBI)
Wellcome Trust Genome Campus, Hinxton
Cambridge CB10 1SD, United Kingdom