[BioC] gcrma error? - linked to makeProbePackage ?

[James W. MacDonald]

Hi Ben,

Benoit Ballester wrote:
> Hi,
> 
> I am trying to use gcrma for the mouse GNF/Novartis data.
> This dataset use a custom affy chip gnGNF1Musa. I got the CDF file and 
> probe file from GEO.
> 
> 
>  > library("gngnf1musacdf")
>  > library("gngnf1musaprobe")
>  > eset.gcrma<-gcrma(Data)
> Adjusting for optical effect.......[more dots].....Done.
> Computing affinitiesError: length(prlen) == 1 is not TRUE

This indicates that you have probes of more than one length (e.g., they 
are not all 25-mers). This might have to do with what you note below, 
that there is an extra column in your probe_tab file. However, there is 
error checking in makeProbePackage that is supposed to catch these sorts 
of things, so I am wondering how you were ever able to make the package 
in the first place.

What do you get from

head(as.data.frame(gngnf1musaprobe))

Does the probe sequence column actually contain probe sequences? If not, 
you will need to remove the extra column from your probe_tab file and 
re-run makeProbePackage.

Best,

Jim




> 
> 
> I create the CDF package like this:
>  > library(makecdfenv)
>  > make.cdf.package("gnGNF1Musa.cdf", species = "Mus_musculus")
> then $> R CMD INSTALL gngnf1musacdf
> 
> 
> 
> When I create the probe package, I have a warning. I don't know if it's 
> linked to the gcrma error have.
> 
>  >  filename<-system.file("extdata","gnGNF1Musa.probe.tab")
>  >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>  >  species<-"Mus_musculus"
>  >  outdir<-tempdir()
>  >  makeProbePackage("gnGNF1Musa", datafile = filename, outdir = outdir, 
> maintainer = me, species = species, version = "0.0.1",force = TRUE)
> Importing the data.
> Creating package in /tmp/RtmpIaiUst/gngnf1musaprobe
> Writing the data.
> Checking the package.
> Building the package.
> [1] "gngnf1musaprobe"
> Warning message:
> file("") only supports open = "w+" and open = "w+b": using the former
>  >
> then $> R CMD INSTALL gngnf1musaprobe
> 
> 
> 
> I use R Version 2.3.1 (2006-06-01)
>  > sessionInfo()
> Version 2.3.1 (2006-06-01)
> x86_64-unknown-linux-gnu
> 
> attached base packages:
> [1] "tools"     "methods"   "stats"     "graphics"  "grDevices" "utils"
> [7] "datasets"  "base"
> 
> other attached packages:
>        gcrma matchprobes  makecdfenv        affy      affyio     Biobase
>      "2.4.1"     "1.4.0"    "1.10.0"    "1.10.0"     "1.0.0"    "1.10.0"
> 
> 
> 
> 
> Do you think that the error I get from gcrma is linked to the cdf/probe 
> package I have made. I also noticed that the probe file I have, has one 
> extra column called "Serial Order". Do you think it might explain the 
> gcrma error ?
> 
> Probe Set Name  Serial Order    Probe X Probe Y Probe Interrogation 
> Position    Probe Sequence  Target Strandedness
> AFFX-18SRNAMur/X00686_3_at      1       256     597     1333 
> GGTGGTGGTGCATGGCCGTTCTTAG       Antisense
> AFFX-18SRNAMur/X00686_3_at      2       71      547     1341 
> TGCATGGCCGTTCTTAGTTGGTGGA       Antisense
> 
> Thanks,
> 
> Ben
> 
> 


-- 
James W. MacDonald, M.S.
Biostatistician
Affymetrix and cDNA Microarray Core
University of Michigan Cancer Center
1500 E. Medical Center Drive
7410 CCGC
Ann Arbor MI 48109
734-647-5623


**********************************************************
Electronic Mail is not secure, may not be read every day, and should not be used for urgent or sensitive issues.