[BioC] gcrma error? - linked to makeProbePackage ?

[Benoit Ballester]

Hi,

I am trying to use gcrma for the mouse GNF/Novartis data.
This dataset use a custom affy chip gnGNF1Musa. I got the CDF file and 
probe file from GEO.


 > library("gngnf1musacdf")
 > library("gngnf1musaprobe")
 > eset.gcrma<-gcrma(Data)
Adjusting for optical effect.......[more dots].....Done.
Computing affinitiesError: length(prlen) == 1 is not TRUE


I create the CDF package like this:
 > library(makecdfenv)
 > make.cdf.package("gnGNF1Musa.cdf", species = "Mus_musculus")
then $> R CMD INSTALL gngnf1musacdf



When I create the probe package, I have a warning. I don't know if it's 
linked to the gcrma error have.

 >  filename<-system.file("extdata","gnGNF1Musa.probe.tab")
 >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
 >  species<-"Mus_musculus"
 >  outdir<-tempdir()
 >  makeProbePackage("gnGNF1Musa", datafile = filename, outdir = outdir, 
maintainer = me, species = species, version = "0.0.1",force = TRUE)
Importing the data.
Creating package in /tmp/RtmpIaiUst/gngnf1musaprobe
Writing the data.
Checking the package.
Building the package.
[1] "gngnf1musaprobe"
Warning message:
file("") only supports open = "w+" and open = "w+b": using the former
 >
then $> R CMD INSTALL gngnf1musaprobe



I use R Version 2.3.1 (2006-06-01)
 > sessionInfo()
Version 2.3.1 (2006-06-01)
x86_64-unknown-linux-gnu

attached base packages:
[1] "tools"     "methods"   "stats"     "graphics"  "grDevices" "utils"
[7] "datasets"  "base"

other attached packages:
       gcrma matchprobes  makecdfenv        affy      affyio     Biobase
     "2.4.1"     "1.4.0"    "1.10.0"    "1.10.0"     "1.0.0"    "1.10.0"




Do you think that the error I get from gcrma is linked to the cdf/probe 
package I have made. I also noticed that the probe file I have, has one 
extra column called "Serial Order". Do you think it might explain the 
gcrma error ?

Probe Set Name  Serial Order    Probe X Probe Y Probe Interrogation 
Position    Probe Sequence  Target Strandedness
AFFX-18SRNAMur/X00686_3_at      1       256     597     1333 
GGTGGTGGTGCATGGCCGTTCTTAG       Antisense
AFFX-18SRNAMur/X00686_3_at      2       71      547     1341 
TGCATGGCCGTTCTTAGTTGGTGGA       Antisense

Thanks,

Ben


-- 
Benoit Ballester, PhD