[BioC] gcrma error? - linked to makeProbePackage ?

[Kasper Daniel Hansen]

On Jul 5, 2007, at 8:48 AM, Benoit Ballester wrote:

>
>
> James W. MacDonald wrote:
>> Hi Ben,
>>
>> Benoit Ballester wrote:
>>> Hi,
>>>
>>> I am trying to use gcrma for the mouse GNF/Novartis data.
>>> This dataset use a custom affy chip gnGNF1Musa. I got the CDF  
>>> file and
>>> probe file from GEO.
>>>
>>>
>>>> library("gngnf1musacdf")
>>>> library("gngnf1musaprobe")
>>>> eset.gcrma<-gcrma(Data)
>>> Adjusting for optical effect.......[more dots].....Done.
>>> Computing affinitiesError: length(prlen) == 1 is not TRUE
>>
>> This indicates that you have probes of more than one length (e.g.,  
>> they
>> are not all 25-mers). This might have to do with what you note below,
>> that there is an extra column in your probe_tab file. However,  
>> there is
>> error checking in makeProbePackage that is supposed to catch these  
>> sorts
>> of things, so I am wondering how you were ever able to make the  
>> package
>> in the first place.
>
> This is what I get when I install gngnf1musaprobe
>> R CMD INSTALL gngnf1musaprobe
> * Installing *source* package 'gngnf1musaprobe' ...
> ** R
> ** data
> ** help
>>>> Building/Updating help pages for package 'gngnf1musaprobe'
>       Formats: text html latex example
>    gngnf1musaprobe                   text    html    latex   example
> ** building package indices ...
> * DONE (gngnf1musaprobe)
>
> looks fine to me
>
>> What do you get from
>>
>> head(as.data.frame(gngnf1musaprobe))
>
> This is what I get :
>
>> library(gngnf1musaprobe)
>> head(as.data.frame(gngnf1musaprobe))
> [1] sequence                     x
> [3] y                            Probe.Set.Name
> [5] Probe.Interrogation.Position Target.Strandedness
> <0 rows> (or 0-length row.names)
>>
>> gngnf1musaprobe
> Object of class probetable data.frame with 0 rows and 6 columns
>>
>> gngnf1musaprobe[1,1]
> [1] NA
>
> This doesn't look right ?!?

No, this show that your probe package does not contain any probes (0  
rows), meaning something major went wrong when it was created. As  
James I am mystified that the package got created anyway, but it is  
certain that you cannot use it as is.

Kasper

>> Does the probe sequence column actually contain probe sequences?  
>> If not,
>> you will need to remove the extra column from your probe_tab file and
>> re-run makeProbePackage.
>
>
>
>
>>
>> Best,
>>
>> Jim
>>
>>
>>
>>
>>>
>>>
>>> I create the CDF package like this:
>>>> library(makecdfenv)
>>>> make.cdf.package("gnGNF1Musa.cdf", species = "Mus_musculus")
>>> then $> R CMD INSTALL gngnf1musacdf
>>>
>>>
>>>
>>> When I create the probe package, I have a warning. I don't know if
>>> it's linked to the gcrma error have.
>>>
>>>>  filename<-system.file("extdata","gnGNF1Musa.probe.tab")
>>>>  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>>>>  species<-"Mus_musculus"
>>>>  outdir<-tempdir()
>>>>  makeProbePackage("gnGNF1Musa", datafile = filename, outdir =
>>> outdir, maintainer = me, species = species, version =  
>>> "0.0.1",force =
>>> TRUE)
>>> Importing the data.
>>> Creating package in /tmp/RtmpIaiUst/gngnf1musaprobe
>>> Writing the data.
>>> Checking the package.
>>> Building the package.
>>> [1] "gngnf1musaprobe"
>>> Warning message:
>>> file("") only supports open = "w+" and open = "w+b": using the  
>>> former
>>>>
>>> then $> R CMD INSTALL gngnf1musaprobe
>>>
>>>
>>>
>>> I use R Version 2.3.1 (2006-06-01)
>>>> sessionInfo()
>>> Version 2.3.1 (2006-06-01)
>>> x86_64-unknown-linux-gnu
>>>
>>> attached base packages:
>>> [1] "tools"     "methods"   "stats"     "graphics"  "grDevices"  
>>> "utils"
>>> [7] "datasets"  "base"
>>>
>>> other attached packages:
>>>        gcrma matchprobes  makecdfenv        affy      affyio      
>>> Biobase
>>>      "2.4.1"     "1.4.0"    "1.10.0"    "1.10.0"     "1.0.0"     
>>> "1.10.0"
>>>
>>>
>>>
>>>
>>> Do you think that the error I get from gcrma is linked to the
>>> cdf/probe package I have made. I also noticed that the probe file I
>>> have, has one extra column called "Serial Order". Do you think it
>>> might explain the gcrma error ?
>>>
>>> Probe Set Name  Serial Order    Probe X Probe Y Probe Interrogation
>>> Position    Probe Sequence  Target Strandedness
>>> AFFX-18SRNAMur/X00686_3_at      1       256     597     1333
>>> GGTGGTGGTGCATGGCCGTTCTTAG       Antisense
>>> AFFX-18SRNAMur/X00686_3_at      2       71      547     1341
>>> TGCATGGCCGTTCTTAGTTGGTGGA       Antisense
>>>
>>> Thanks,
>>>
>>> Ben
>>>
>>>
>>
>>
>
> -- 
> Benoit Ballester, PhD
> Ensembl Team
> European Bioinformatics Institute (EMBL-EBI)
> Wellcome Trust Genome Campus, Hinxton
> Cambridge CB10 1SD, United Kingdom
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/ 
> gmane.science.biology.informatics.conductor