[BioC] [Fwd: help in annotation ILLUMINA probes]

[Mark Dunning]

Hi Nathalie,

You can use the illumina Bioconductor annotation packages to do this.
The particular one you need is illuminaMousev2.db

>library(illuminaMousev2.db)

> ids = c("ILMN_1250814", "ILMN_1257855", "ILMN_2537948", "ILMN_3144164", "ILMN_2636200")

> mget(ids, illuminaMousev2GENOMICLOCATION)
$ILMN_1250814
[1] "chr9:53240676:53240725:+"

$ILMN_1257855
[1] "chrX:96269326:96269375:+"

$ILMN_2537948
[1] "chr6:68192672:68192721:+"

$ILMN_3144164
[1] "chr8:11004508:11004557:-"

$ILMN_2636200
[1] "chr10:5324478:5324527:+"

The coordinates are based on the mm9 assembly.

You can also retrieve the probe sequences themselves in a similar technique.

> mget(ids, illuminaMousev2PROBESEQUENCE)
$ILMN_1250814
[1] "GGATTCCCTTTTCTGAGCGATGGACCTACCTTCAAGCCCACTTTCCAGCG"

$ILMN_1257855
[1] "CCTCATGCCTTTTGCCTACAGTGGTGGTCTATAAGAACAGTCCTTTTGGC"

$ILMN_2537948
[1] "GGGCAAGGACCACAGCCAACTTCCTCTTACAAGCCACACCGACTTTGTCC"

$ILMN_3144164
[1] "CCAGGCACTGGAGCTTTGCCCTCTGCCAGCACCTATGCAAGCATCGACTT"

$ILMN_2636200
[1] "TTTGCCCGATCCTTCCATCCGATGCTCAGATATACCAACGGTCCTCCTCC"

Running the following will list all available mappings in the package.

> illuminaMousev2()

Best wishes,

Mark

On Mon, May 16, 2011 at 6:44 PM, Mete Civelek <mcivelek at mednet.ucla.edu> wrote:
> Illumina has this information on their manifest files for each beadchip.
>
> -----Original Message-----
> From: bioconductor-bounces at r-project.org
> [mailto:bioconductor-bounces at r-project.org] On Behalf Of Nathalie Conte
> Sent: Monday, May 16, 2011 10:14 AM
> To: Bioconductor mailing list
> Subject: [BioC] [Fwd: help in annotation ILLUMINA probes]
>
> Dear all,
> I have a set of probes Ids from illumina beads arrays
>
> illuminaProbeID
> ILMN_1250814
> ILMN_1257855
> ILMN_2537948
> ILMN_3144164
> ILMN_2636200
>
>
> what is the best way to fetch the chromosomal location of those ( chr:
> start :end)?
>
> Many thanks
> Nathalie
>
>
> --
>  The Wellcome Trust Sanger Institute is operated by Genome Research
>  Limited, a charity registered in England with number 1021457 and a
>  company registered in England with number 2742969, whose registered
>  office is 215 Euston Road, London, NW1 2BE.
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor
>
>
> IMPORTANT WARNING:  This email (and any attachments) is ...{{dropped:9}}
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
>