[BioC] Problem getting the exact ProbeNames

[James W. MacDonald]

Hi Karsten,

On 1/11/2011 12:56 PM, Karsten Voigt wrote:
> Dear all,
>
> I am currently working on a project where I need to get the exact IDs of
> probes of a custom Affymetrix Chip in order to merge it with another
> list containing the sequence.
>
> I am using this small R script for creating the list:
>
> mitdata <- ReadAffy();
> stddata <- apply(pm(mitdata), 2, bg.adjust);
> nrmdata <- normalize.quantiles(stddata);
> namedata <- probeNames(mitdata);
> enddata <- cbind(namedata, nrmdata);
> write.table(enddata, file="probesdata.txt",sep="\t");
>
> This is an output example
>
> ...
> 145 TZG_ARR_0001_x_at 135.115780787133 ...
> 146 TZG_ARR_0001_x_at 147.346049115501 ...
> 147 TZG_ARR_0001_x_at 203.840215898533 ...
> 148 TZG_ARR_0003_x_at 48.7635207480323 ...
> ...
>
> As you can see, a number of probes have the same name but refer to
> different oligos. The number in front of the row is just added by me,
> therefore you can ignore it.
>
> I received a list containing the probe name, a couple of other
> information AND the sequence.
>
> This is a part of it:
>
> 15 ggagattgtttgtaatcaaaatgaa TGZ_ARR_0001_x ! 2398 0 176 200 + 1
> 103 gcaaatttacttctaacagctgatc TGZ_ARR_0001_x ! 2398 1 264 288 + 1
> 188 ttgatgcaactgtaaacaaaagtgg TGZ_ARR_0001_x ! 2398 2 349 373 + 1
> 15 gatagattcttcaagtaacaatact TGZ_ARR_0003_x ! 2400 0 2046 2070 + 1
>
> This should be the same area.
>
> In this received list, I can identify the unique probes using the 2
> numbers right after the exclamation mark, which are referring to the
> position on the chip, I guess. How can I extract those coordinates for
> my own list? I tried it with indices2xy, however I failed to get it
> running since I don't understand how to use this function correctly.

Using the hgu95av2cdf as an example:

 > library(hgu95av2cdf)
 > x <- as.list(hgu95av2cdf)
 > x <- x[order(names(x))]
 > x <- unlist(sapply(x, function(x) x[,1]))
 > xys <- indices2xy(x, cdf="hgu95av2cdf")
 > head(xys)
            x   y
1000_at1 399 559
1000_at2 544 185
1000_at3 530 505
1000_at4 617 349
1000_at5 459 489
1000_at6 408 545

Best,

Jim


>
> Thanks in advance for all answers,
>
> Karsten Voigt
>
>
>
>
>

-- 
James W. MacDonald, M.S.
Biostatistician
Douglas Lab
University of Michigan
Department of Human Genetics
5912 Buhl
1241 E. Catherine St.
Ann Arbor MI 48109-5618
734-615-7826
**********************************************************
Electronic Mail is not secure, may not be read every day, and should not be used for urgent or sensitive issues