[BioC] Problem getting the exact ProbeNames

[Karsten Voigt]

Dear all,

I am currently working on a project where I need to get the exact IDs of 
probes of a custom Affymetrix Chip in order to merge it with another 
list containing the sequence.

I am using this small R script for creating the list:

mitdata <- ReadAffy();
stddata <- apply(pm(mitdata), 2, bg.adjust);
nrmdata <- normalize.quantiles(stddata);
namedata <- probeNames(mitdata);
enddata <- cbind(namedata, nrmdata);
write.table(enddata, file="probesdata.txt",sep="\t");

This is an output example

...
145 TZG_ARR_0001_x_at    135.115780787133 ...
146 TZG_ARR_0001_x_at    147.346049115501 ...
147 TZG_ARR_0001_x_at    203.840215898533 ...
148 TZG_ARR_0003_x_at    48.7635207480323 ...
...

As you can see, a number of probes have the same name but refer to 
different oligos. The number in front of the row is just added by me, 
therefore you can ignore it.

I received a list containing the probe name, a couple of other 
information AND the sequence.

This is a part of it:

15    ggagattgtttgtaatcaaaatgaa    TGZ_ARR_0001_x    !    2398    0    
176    200    +    1
103  gcaaatttacttctaacagctgatc    TGZ_ARR_0001_x    !    2398    1    
264    288    +    1
188  ttgatgcaactgtaaacaaaagtgg    TGZ_ARR_0001_x    !    2398    2    
349    373    +    1
15    gatagattcttcaagtaacaatact    TGZ_ARR_0003_x    !    2400    0    
2046    2070    +    1

This should be the same area.

In this received list, I can identify the unique probes using the 2 
numbers right after the exclamation mark, which are referring to the 
position on the chip, I guess. How can I extract those coordinates for 
my own list? I tried it with indices2xy, however I failed to get it 
running since I don't understand how to use this function correctly.

Thanks in advance for all answers,

Karsten Voigt





-- 

_________________________________________________
Karsten Voigt, Msc.
Experimentelle Bioinformatik, Hess Group
University of Freiburg, BIO III
t: 0761-2032708
m: 0176-61110420
e: karsten.voigt at biologie.uni-freiburg.de