[BioC] problem with lumiRatAll.db

[Flora Fan]

Hi Gilbert,

I installed the latest version BioC (2.5) and lumiRatAll.db (1.8.1). But 
I still can't find the annotation for some the probes, such as nuID = 
Niuq09_43JW4K1SOe4, as I described in the previous email. Any other 
suggestion?

 > sessionInfo()
R version 2.10.1 (2009-12-14)
i386-apple-darwin9.8.0

locale:
[1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
 [1] lumiRatAll.db_1.8.1    org.Rn.eg.db_2.3.5     lumiRatIDMapping_1.4.0
 [4] limma_3.2.1            lumi_1.12.2            MASS_7.3-4           
 [7] RSQLite_0.8-1          DBI_0.2-5              preprocessCore_1.8.0 
[10] mgcv_1.6-1             affy_1.24.2            annotate_1.24.1      
[13] AnnotationDbi_1.8.1    Biobase_2.6.1        

loaded via a namespace (and not attached):
[1] affyio_1.14.0      grid_2.10.1        lattice_0.17-26    
Matrix_0.999375-33
[5] nlme_3.1-96        tools_2.10.1       xtable_1.5-6     

Thanks a lot,
Flora

Gilbert Feng wrote:
> Hi, Flora
>
> It looks you are using the old version lumiMouseAll.db. Please install the
> latest version BioC (2.5) and lumiMouseAll.db(1.8.1).
>
> If you have any more question or comment, just let me know.
>
> Thanks for using lumi and lumi annotation packages!
>
> Gilbert
>
> On 1/20/10 9:40 AM, "Flora Fan" <fanx0038 at umn.edu> wrote:
>
>   
>> Hi,
>>
>> I am trying to use lumi package to analyze Illumina RatRef-12_V1.
>> However, about 30% of the probe IDs don't have annotations in
>> lumiRatAll.db_1.6.1. Is it because the mapping didn't pass the threshold
>> or am I doing something wrong?
>>
>> For example, for probe ID ILMN_1355285:
>> nuID = Niuq09_43JW4K1SOe4
>> probe seq = GAGGTGGGGTCATTCTTGTGATCTAGCCCGTGAAGGTCCCAGATGCTGTG
>> manual blast result as well as Illumina annotation file
>> RatRef-12_V1_0_R3_11222119_A.txt shows that it mapped to A4galt.
>>
>> But when I do getSYMBOL, no symbol was returned.
>>     
>>> getSYMBOL("Niuq09_43JW4K1SOe4","lumiRatAll.db")
>>>       
>> Niuq09_43JW4K1SOe4
>>                 NA
>> or
>>     
>>>  x<- lumiRatAllACCNUM
>>>  mapped_probes <- mappedkeys(x)
>>>  ind<-c(1:16134)[mapped_probes == "Niuq09_43JW4K1SOe4"]
>>>       
>> It returned integer(0)
>>
>> How can I annotate these IDs? Can I keep the original gene symbols that
>> were generated from GenomeStudio version 1.0.6 as identifiers in lumi
>> package?
>>
>> Here is the sessionInfo()
>> R version 2.9.1 (2009-06-26)
>> i386-apple-darwin8.11.1
>>
>> locale:
>> en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8
>>
>> attached base packages:
>> [1] stats     graphics  grDevices utils     datasets  methods   base
>>
>> other attached packages:
>>  [1] lumiRatAll.db_1.6.1    lumiRatV1_1.2.0        beadarray_1.12.1
>>  [4] hwriter_1.1            lumiRatIDMapping_1.2.1 limma_2.18.0
>>  [7] lumi_1.10.2            RSQLite_0.7-1          DBI_0.2-4
>> [10] preprocessCore_1.6.0   mgcv_1.5-5             affy_1.22.0
>> [13] annotate_1.22.0        AnnotationDbi_1.6.0    Biobase_2.4.1
>>
>> loaded via a namespace (and not attached):
>> [1] affyio_1.12.0   grid_2.9.1      lattice_0.17-25 nlme_3.1-92
>> [5] tools_2.9.1     xtable_1.5-5
>>
>> Your help will be greatly appreciated.
>> -Flora
>>     
>
>
>
>