[BioC] problem with lumiRatAll.db

[Gilbert Feng]

Hi, Flora

It looks you are using the old version lumiMouseAll.db. Please install the
latest version BioC (2.5) and lumiMouseAll.db(1.8.1).

If you have any more question or comment, just let me know.

Thanks for using lumi and lumi annotation packages!

Gilbert

On 1/20/10 9:40 AM, "Flora Fan" <fanx0038 at umn.edu> wrote:

> Hi,
> 
> I am trying to use lumi package to analyze Illumina RatRef-12_V1.
> However, about 30% of the probe IDs don't have annotations in
> lumiRatAll.db_1.6.1. Is it because the mapping didn't pass the threshold
> or am I doing something wrong?
> 
> For example, for probe ID ILMN_1355285:
> nuID = Niuq09_43JW4K1SOe4
> probe seq = GAGGTGGGGTCATTCTTGTGATCTAGCCCGTGAAGGTCCCAGATGCTGTG
> manual blast result as well as Illumina annotation file
> RatRef-12_V1_0_R3_11222119_A.txt shows that it mapped to A4galt.
> 
> But when I do getSYMBOL, no symbol was returned.
>> getSYMBOL("Niuq09_43JW4K1SOe4","lumiRatAll.db")
> Niuq09_43JW4K1SOe4
>                 NA
> or
>>  x<- lumiRatAllACCNUM
>>  mapped_probes <- mappedkeys(x)
>>  ind<-c(1:16134)[mapped_probes == "Niuq09_43JW4K1SOe4"]
> It returned integer(0)
> 
> How can I annotate these IDs? Can I keep the original gene symbols that
> were generated from GenomeStudio version 1.0.6 as identifiers in lumi
> package?
> 
> Here is the sessionInfo()
> R version 2.9.1 (2009-06-26)
> i386-apple-darwin8.11.1
> 
> locale:
> en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8
> 
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods   base
> 
> other attached packages:
>  [1] lumiRatAll.db_1.6.1    lumiRatV1_1.2.0        beadarray_1.12.1
>  [4] hwriter_1.1            lumiRatIDMapping_1.2.1 limma_2.18.0
>  [7] lumi_1.10.2            RSQLite_0.7-1          DBI_0.2-4
> [10] preprocessCore_1.6.0   mgcv_1.5-5             affy_1.22.0
> [13] annotate_1.22.0        AnnotationDbi_1.6.0    Biobase_2.4.1
> 
> loaded via a namespace (and not attached):
> [1] affyio_1.12.0   grid_2.9.1      lattice_0.17-25 nlme_3.1-92
> [5] tools_2.9.1     xtable_1.5-5
> 
> Your help will be greatly appreciated.
> -Flora