[BioC] gcrma error? - linked to makeProbePackage ?

[Cei Abreu-Goodger]

Is there some reason for you not wanting to update your BioC 
distribution? It might even solve the problem you had with the 
matchprobes package...

Cei

Benoit Ballester wrote:
> Hi,
>
> already tested - and doesn't seem to work - it seems that there is a 
> version issue.
>
> > library(gngnf1musaprobe)
> Error: package 'matchprobes' 1.4.0 was found, but >= 1.8.1 is required 
> by 'gngnf1musaprobe'
>
> Would that explain why it doesn't work ?
> Also I realized that I don't specify  package="matchprobes" when I 
> load my file.
>
>  filename<-system.file("extdata","gnGNF1Musa.probe.6tab")
>
>
> doing so :
>  filename<-system.file("extdata","gnGNF1Musa.probe.6tab", 
> package="matchprobes")
> and re-creating gngnf1musaprobe, gives me the same error than with cei 
> probe package.
>
> would that be the reason why something goes wrong ?
>
> Cheers,
>
> Ben
>
> Cei Abreu-Goodger wrote:
>> Might I suggest, as a temporal solution, that you use the packages 
>> that I've previously built and posted on the bioC mailing list?
>>
>> http://article.gmane.org/gmane.science.biology.informatics.conductor/13659 
>>
>>
>> Cheers,
>>
>> Cei
>>
>> Benoit Ballester wrote:
>>> James W. MacDonald wrote:
>>>  
>>>> Hi Ben,
>>>>
>>>> Benoit Ballester wrote:
>>>>   
>>>>> Hi,
>>>>>
>>>>> I am trying to use gcrma for the mouse GNF/Novartis data.
>>>>> This dataset use a custom affy chip gnGNF1Musa. I got the CDF file 
>>>>> and probe file from GEO.
>>>>>
>>>>>
>>>>>  > library("gngnf1musacdf")
>>>>>  > library("gngnf1musaprobe")
>>>>>  > eset.gcrma<-gcrma(Data)
>>>>> Adjusting for optical effect.......[more dots].....Done.
>>>>> Computing affinitiesError: length(prlen) == 1 is not TRUE
>>>>>       
>>>> This indicates that you have probes of more than one length (e.g., 
>>>> they are not all 25-mers). This might have to do with what you note 
>>>> below, that there is an extra column in your probe_tab file. 
>>>> However, there is error checking in makeProbePackage that is 
>>>> supposed to catch these sorts of things, so I am wondering how you 
>>>> were ever able to make the package in the first place.
>>>>
>>>> What do you get from
>>>>
>>>> head(as.data.frame(gngnf1musaprobe))
>>>>
>>>> Does the probe sequence column actually contain probe sequences? If 
>>>> not, you will need to remove the extra column from your probe_tab 
>>>> file and re-run makeProbePackage.
>>>>     
>>>
>>> Hi,
>>>
>>> This is what I have done - I have *removed* the extra column to have 
>>> a tab file which looks like that :
>>>
>>> AFFX-BioB-5_at 429 502 123 TCGTCAGGTGCAGGTCAGCACGTTG Antisense
>>> AFFX-BioB-5_at 430 502 132 GCAGGTCAGCACGTTGCTGTCGATT Antisense
>>> AFFX-BioB-5_at 431 502 138 CAGCACGTTGCTGTCGATTAAGACC Antisense
>>> AFFX-BioB-5_at 432 502 147 GCTGTCGATTAAGACCGGAGCTTGT Antisense
>>> AFFX-BioB-5_at 433 502 165 AGCTTGTCCGGAAGATTGCAAATAC Antisense
>>> AFFX-BioB-5_at 434 502 177 AGATTGCAAATACTGCCCGCAAACG Antisense
>>> AFFX-BioB-5_at 435 502 183 CAAATACTGCCCGCAAACGTCGCGC Antisense
>>> AFFX-BioB-5_at 436 502 246 TGAACAGGTGCTGGAGTCGGCGCGC Antisense
>>>
>>> exactly like in the HG-U95Av2_probe_tab file that is in 
>>> matrchprobes/extdata/
>>>
>>>
>>>
>>> I rerun the makeProbePackage again
>>>  >  library(matchprobes)
>>>  >  filename<-system.file("extdata","gnGNF1Musa.probe.6tab")
>>>  >
>>>  >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>>>  >  species<-"Mus_musculus"
>>>  >
>>>  >  makeProbePackage("gnGNF1Musa", datafile = filename, maintainer = 
>>> me, species = species, version = "0.0.1",force = TRUE)
>>> Importing the data.
>>> Creating package in ./gngnf1musaprobe
>>> Existing ./gngnf1musaprobe was removed.
>>> Writing the data.
>>> Checking the package.
>>> Building the package.
>>> [1] "gngnf1musaprobe"
>>> Warning message:
>>> file("") only supports open = "w+" and open = "w+b": using the former
>>>
>>>
>>>
>>> Then I reinstall gngnf1musaprobe:
>>>
>>> benoit at xxxx > R CMD INSTALL gngnf1musaprobe
>>> * Installing *source* package 'gngnf1musaprobe' ...
>>> ** R
>>> ** data
>>> ** help
>>>   >>> Building/Updating help pages for package 'gngnf1musaprobe'
>>>       Formats: text html latex example
>>>    gngnf1musaprobe                   text    html    latex   example
>>> ** building package indices ...
>>> * DONE (gngnf1musaprobe)
>>>
>>>
>>>
>>> If I look at :
>>>
>>>  > library(gngnf1musaprobe)
>>>  > head(as.data.frame(gngnf1musaprobe))
>>> [1] sequence                     x
>>> [3] y                            Probe.Set.Name
>>> [5] Probe.Interrogation.Position Target.Strandedness
>>> <0 rows> (or 0-length row.names)
>>>
>>>  > gngnf1musaprobe
>>> Object of class probetable data.frame with 0 rows and 6 columns
>>>  > gngnf1musaprobe[1,1]
>>> [1] NA
>>>
>>>
>>> So I still get nothing.
>>> Am I doing something silly when I create gngnf1musaprobe or there 
>>> something wrong in the code ?
>>>
>>>
>>> I have tried with the HG-U95Av2_probe_tab file from 
>>> matchprobes/extdata, and recreated the probe env
>>>
>>>  >  library(matchprobes)
>>>  >  filename<-system.file("extdata"," HG-U95Av2_probe_tab")
>>>  >
>>>  >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>>>  >  species<-"Homo_sapiens"
>>>  >  makeProbePackage("HG-U95Av2", datafile = filename, maintainer = 
>>> me, species = species, version = "0.0.1",force = TRUE)
>>> Importing the data.
>>> Creating package in ./hgu95av2probe
>>> Writing the data.
>>> Checking the package.
>>> Building the package.
>>> [1] "hgu95av2probe"
>>> Warning message:
>>> file("") only supports open = "w+" and open = "w+b": using the former
>>>
>>>
>>> then :
>>>   R CMD INSTALL hgu95av2probe
>>>
>>> back in R
>>>  > library(hgu95av2probe)
>>>  > hgu95av2probe
>>> Object of class probetable data.frame with 0 rows and 6 columns.
>>>  > hgu95av2probe[1,1]
>>> [1] NA
>>>
>>>
>>> Wtill nothing with the examples. Looks like my file is not the 
>>> problem, and the problem is somewhere else.
>>> Any ideas ?
>>>
>>>
>>> Cheers,
>>>
>>> Ben
>>>
>>>   
>>
>>
>>
>



-- 
The Wellcome Trust Sanger Institute is operated by Genome Research 
Limited, a charity registered in England with number 1021457 and a 
company registered in England with number 2742969, whose registered 
office is 215 Euston Road, London, NW1 2BE.