[BioC] gcrma error? - linked to makeProbePackage ?

[Benoit Ballester]

Hi,

already tested - and doesn't seem to work - it seems that there is a 
version issue.

 > library(gngnf1musaprobe)
Error: package 'matchprobes' 1.4.0 was found, but >= 1.8.1 is required 
by 'gngnf1musaprobe'

Would that explain why it doesn't work ?
Also I realized that I don't specify  package="matchprobes" when I load 
my file.

  filename<-system.file("extdata","gnGNF1Musa.probe.6tab")


doing so :
  filename<-system.file("extdata","gnGNF1Musa.probe.6tab", 
package="matchprobes")
and re-creating gngnf1musaprobe, gives me the same error than with cei 
probe package.

would that be the reason why something goes wrong ?

Cheers,

Ben

Cei Abreu-Goodger wrote:
> Might I suggest, as a temporal solution, that you use the packages that 
> I've previously built and posted on the bioC mailing list?
> 
> http://article.gmane.org/gmane.science.biology.informatics.conductor/13659
> 
> Cheers,
> 
> Cei
> 
> Benoit Ballester wrote:
>> James W. MacDonald wrote:
>>  
>>> Hi Ben,
>>>
>>> Benoit Ballester wrote:
>>>    
>>>> Hi,
>>>>
>>>> I am trying to use gcrma for the mouse GNF/Novartis data.
>>>> This dataset use a custom affy chip gnGNF1Musa. I got the CDF file 
>>>> and probe file from GEO.
>>>>
>>>>
>>>>  > library("gngnf1musacdf")
>>>>  > library("gngnf1musaprobe")
>>>>  > eset.gcrma<-gcrma(Data)
>>>> Adjusting for optical effect.......[more dots].....Done.
>>>> Computing affinitiesError: length(prlen) == 1 is not TRUE
>>>>       
>>> This indicates that you have probes of more than one length (e.g., 
>>> they are not all 25-mers). This might have to do with what you note 
>>> below, that there is an extra column in your probe_tab file. However, 
>>> there is error checking in makeProbePackage that is supposed to catch 
>>> these sorts of things, so I am wondering how you were ever able to 
>>> make the package in the first place.
>>>
>>> What do you get from
>>>
>>> head(as.data.frame(gngnf1musaprobe))
>>>
>>> Does the probe sequence column actually contain probe sequences? If 
>>> not, you will need to remove the extra column from your probe_tab 
>>> file and re-run makeProbePackage.
>>>     
>>
>> Hi,
>>
>> This is what I have done - I have *removed* the extra column to have a 
>> tab file which looks like that :
>>
>> AFFX-BioB-5_at 429 502 123 TCGTCAGGTGCAGGTCAGCACGTTG Antisense
>> AFFX-BioB-5_at 430 502 132 GCAGGTCAGCACGTTGCTGTCGATT Antisense
>> AFFX-BioB-5_at 431 502 138 CAGCACGTTGCTGTCGATTAAGACC Antisense
>> AFFX-BioB-5_at 432 502 147 GCTGTCGATTAAGACCGGAGCTTGT Antisense
>> AFFX-BioB-5_at 433 502 165 AGCTTGTCCGGAAGATTGCAAATAC Antisense
>> AFFX-BioB-5_at 434 502 177 AGATTGCAAATACTGCCCGCAAACG Antisense
>> AFFX-BioB-5_at 435 502 183 CAAATACTGCCCGCAAACGTCGCGC Antisense
>> AFFX-BioB-5_at 436 502 246 TGAACAGGTGCTGGAGTCGGCGCGC Antisense
>>
>> exactly like in the HG-U95Av2_probe_tab file that is in 
>> matrchprobes/extdata/
>>
>>
>>
>> I rerun the makeProbePackage again
>>  >  library(matchprobes)
>>  >  filename<-system.file("extdata","gnGNF1Musa.probe.6tab")
>>  >
>>  >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>>  >  species<-"Mus_musculus"
>>  >
>>  >  makeProbePackage("gnGNF1Musa", datafile = filename, maintainer = 
>> me, species = species, version = "0.0.1",force = TRUE)
>> Importing the data.
>> Creating package in ./gngnf1musaprobe
>> Existing ./gngnf1musaprobe was removed.
>> Writing the data.
>> Checking the package.
>> Building the package.
>> [1] "gngnf1musaprobe"
>> Warning message:
>> file("") only supports open = "w+" and open = "w+b": using the former
>>
>>
>>
>> Then I reinstall gngnf1musaprobe:
>>
>> benoit at xxxx > R CMD INSTALL gngnf1musaprobe
>> * Installing *source* package 'gngnf1musaprobe' ...
>> ** R
>> ** data
>> ** help
>>   >>> Building/Updating help pages for package 'gngnf1musaprobe'
>>       Formats: text html latex example
>>    gngnf1musaprobe                   text    html    latex   example
>> ** building package indices ...
>> * DONE (gngnf1musaprobe)
>>
>>
>>
>> If I look at :
>>
>>  > library(gngnf1musaprobe)
>>  > head(as.data.frame(gngnf1musaprobe))
>> [1] sequence                     x
>> [3] y                            Probe.Set.Name
>> [5] Probe.Interrogation.Position Target.Strandedness
>> <0 rows> (or 0-length row.names)
>>
>>  > gngnf1musaprobe
>> Object of class probetable data.frame with 0 rows and 6 columns
>>  > gngnf1musaprobe[1,1]
>> [1] NA
>>
>>
>> So I still get nothing.
>> Am I doing something silly when I create gngnf1musaprobe or there 
>> something wrong in the code ?
>>
>>
>> I have tried with the HG-U95Av2_probe_tab file from 
>> matchprobes/extdata, and recreated the probe env
>>
>>  >  library(matchprobes)
>>  >  filename<-system.file("extdata"," HG-U95Av2_probe_tab")
>>  >
>>  >  me<-"Benoit Ballester<benoit at ebi.ac.uk>"
>>  >  species<-"Homo_sapiens"
>>  >  makeProbePackage("HG-U95Av2", datafile = filename, maintainer = 
>> me, species = species, version = "0.0.1",force = TRUE)
>> Importing the data.
>> Creating package in ./hgu95av2probe
>> Writing the data.
>> Checking the package.
>> Building the package.
>> [1] "hgu95av2probe"
>> Warning message:
>> file("") only supports open = "w+" and open = "w+b": using the former
>>
>>
>> then :
>>   R CMD INSTALL hgu95av2probe
>>
>> back in R
>>  > library(hgu95av2probe)
>>  > hgu95av2probe
>> Object of class probetable data.frame with 0 rows and 6 columns.
>>  > hgu95av2probe[1,1]
>> [1] NA
>>
>>
>> Wtill nothing with the examples. Looks like my file is not the 
>> problem, and the problem is somewhere else.
>> Any ideas ?
>>
>>
>> Cheers,
>>
>> Ben
>>
>>   
> 
> 
> 

-- 
Benoit Ballester, PhD
Ensembl Team
European Bioinformatics Institute (EMBL-EBI)
Wellcome Trust Genome Campus, Hinxton
Cambridge CB10 1SD, United Kingdom