[BioC] gcrma problem

[James W. MacDonald]

What happens if you do:

library(disdiv712aprobe)
data.frame(disdiv712aprobe)[1:10,]

You should get something like:

                     sequence    x   y Probe.Set.Name 
Probe.Interrogation.Position Target.Strandedness
1  CACCCAGCTGGTCCTGTGGATGGGA  718 317      1007_s_at 
      3330           Antisense
2  GCCCCACTGGACAACACTGATTCCT 1105 483      1007_s_at 
      3443           Antisense
3  TGGACCCCACTGGCTGAGAATCTGG  584 901      1007_s_at 
      3512           Antisense
4  AAATGTTTCCTTGTGCCTGCTCCTG  192 205      1007_s_at 
      3563           Antisense
5  TCCTTGTGCCTGCTCCTGTACTTGT  844 979      1007_s_at 
      3570           Antisense
6  TGCCTGCTCCTGTACTTGTCCTCAG  537 971      1007_s_at 
      3576           Antisense
7  TCCTGTACTTGTCCTCAGCTTGGGC  748 983      1007_s_at 
      3583           Antisense
8  ACTTGTCCTCAGCTTGGGCTTCTTC 1119 177      1007_s_at 
      3589           Antisense
9  TCCTCCATCACCTGAAACACTGGAC  504 983      1007_s_at 
      3615           Antisense
10 AAGCCTATACGTTTCTGTGGAGTAA  624 245      1007_s_at 
      3713           Antisense
 >

How about

library(disdiv712acdf)
get(ls(disdiv712acdf), disdiv712acdf)

You should get something like:

            pm      mm
  [1,]  369707  370871
  [2,]  563318  564482
  [3,] 1049349 1050513
  [4,]  238813  239977
  [5,] 1140401 1141565
  [6,] 1130782 1131946
  [7,] 1144961 1146125
  [8,]  207148  208312
  [9,] 1144717 1145881
[10,]  285805  286969
[11,] 1351879 1353043
[12,] 1170814 1171978
[13,]  906807  907971
[14,]  547053  548217
[15,] 1221909 1223073
[16,]   27611   28775




Wenqiong Chen wrote:
> This is something which frustrates me again!
> Yes, I did do "R CMD INSTALL" from the dos command line, and I can clearly see that the package is in the R library. 
> Regarding the naming issue, I did not specify anything. Right now, the two packages I built in the library is "disdiv712acdf", and "disdiv712aprobe". Looks pretty consistent.
> There is clearly something not trivial there which caused the problem, maybe related to my computer? I am going to give a try in the unix system and see what happens.
> Thanks a lot for your help!
> Wenqiong
> 
> 
> -----Original Message-----
> From: James W. MacDonald [mailto:jmacdon at med.umich.edu] 
> Sent: Tuesday, March 29, 2005 11:38 AM
> To: Wenqiong Chen
> Cc: Bioconductor at stat.math.ethz.ch
> Subject: Re: [BioC] gcrma problem
> 
> Wenqiong Chen wrote:
> 
>>O.K, here is the step where the error started to occur when I run the 
>>content of the function "compute.affinities".. "
>>
>>
>>>getProbePackage(probepackagename)
>>
>>[1] "Checking to see if your internet connection works..." Error in 
>>install.packages2(probepackage, lib = lib) : recursive default 
>>argument reference " Alternatively, when I use:
>>
>>
>>>getProbePackage(disdiv712aprobe)		#disdiv712aprobe is the
>>>probepackagename
>>
>>Warning messages: 1: the condition has length > 1 and only the first 
>>element will be used in: if (package %in% c("ctest", "eda", "modreg", 
>>"mva", "nls", "stepfun", 2: the condition has length > 1 and only the 
>>first element will be used in: if (package == "mle") { 3: the 
>>condition has length > 1 and only the first element will be used in:
>>if (package == "lqs") { [1] "Checking to see if your internet 
>>connection works..." Note: You did not specify a download type.
>>Using a default value of: Win32 This will be fine for almost all users
>>
>>Error in FUN(X[[2]], ...) : Malformed 'pkgs' parameter " I also 
>>noticed that when I execute this line, it attempts to download 
>>something from BioConductor.
>>
>>As Jim already realized, this is not a public GeneChip, but did adopt 
>>a standard Affy design. I made the cdf and probe packages by myself 
>>using the functions in BioConductor. The R version I am using is 
>>R2.0.1, the gcrma package is from the BioConductor 1.5 release.
> 
> 
> The function getProbePackage() is trying to download the probe package from the BioC website because it thinks the correct one is not installed. When you made the cdf and probe packages yourself, did you specify a name for either? If so, this may be the cause of the problem.
> 
> In addition, after making the packages, did you install them using R CMD INSTALL? If you didn't install them, then they will not be available for R to use, which is another possibility.
> 
> If you are on a *nix machine, installing should be straightforward. If you are on MacOS or Windows, you may need to get some tools. If so, you will need to see the corresponding FAQ on the R-project website.
> 
> HTH,
> 
> Jim
> 
> 
> 
> --
> James W. MacDonald
> Affymetrix and cDNA Microarray Core
> University of Michigan Cancer Center
> 1500 E. Medical Center Drive
> 7410 CCGC
> Ann Arbor MI 48109
> 734-647-5623
> 
> 
> 
> 
> ------------------------------------------------------------------------------
> This email message and any attachments are confidential an...{{dropped}}