[BioC] affy, probeName and sequence information ?

[laurent buffat]

Hi all,

With the affy package, I can have the signal(pm or mm) for all the probe for
one probeSet.
For example (if my affbatch "af" is from two HU133A .CEL)

> pm(af,"1007_s_at")

             a1    a2
1007_s_at1	713.0 575.3
1007_s_at2  ...
...
1007_s_at16 ...   ....

On an other hand, I can have the sequence and the position for the
differents probe of a given probe set :

 POG    TARGET                  RESIDUES POSITIONX POSITIONY
1  3330 1007_s_at CACCCAGCTGGTCCTGTGGATGGGA       467       181
2  3443 1007_s_at GCCCCACTGGACAACACTGATTCCT       531       299
3  3512 1007_s_at TGGACCCCACTGGCTGAGAATCTGG        86       557
4  3563 1007_s_at AAATGTTTCCTTGTGCCTGCTCCTG       365       115
...
16 3878 1007_s_at ATATATGGACCTAGCTTGAGGCAAT       308        15

and my problem is how I can link the "probename" (1007_s_at1) to the
corresponding sequence ?. The sequence of 1007_s_at1 is "CACC..." or
"GCCC.." or etc... ?
Is there a available relation between the "number" of the probe in the Affy
package and the position ?

Tanks for your help.

L. buffat