[BioC] Annotate blastSequences Returns No Result

[Martin Morgan]

On 08/18/2013 07:00 PM, Dario Strbenac wrote:
> Thanks. That worked, although there is no description or score returned with
> the results. It must still be at an early stage of development, which I
> wasn't expecting in the release branch of a package.

Hi Dario -- Yep, it's at an early stage of development in some sense, but from

   http://bioconductor.org/packages/release/bioc/html/annotate.html

we see the package has been there since BioC 1.6 or earlier, and actually from 
the svn log the first entry related to this package is

------------------------------------------------------------------------
r21 | rgentlem | 2001-07-29 14:51:48 -0700 (Sun, 29 Jul 2001) | 2 lines

so actually you're getting something that's been around for quite a while! If 
you're finding this package generally useful but with some functionality missing 
(I think back in the day people were thrilled to be able to query an NCBI 
resource programmatically), then please don't hesitate to provide a patch 
against the current development code -- looks like the code just parses an xml 
document, so we're probably just an xpathSApply away from something useful...

   http://bioconductor.org/developers/how-to/source-control/

Martin

>
> ________________________________________ From: Martin Morgan
> [mtmorgan at fhcrc.org] Sent: Monday, 19 August 2013 12:07 AM To: Dario
> Strbenac Cc: bioconductor at r-project.org Subject: Re: [BioC] Annotate
> blastSequences Returns No Result
>
> On 08/18/2013 02:00 AM, Dario Strbenac wrote:
>> Hello,
>>
>> The function blastSequences in the package Annotate isn't returning
>> anything for the following example, a sequence from the beginning of GAPDH
>> in the human genome reference sequence.
>>
>>> blastSequences("TGGGACTGGCTGAGCCTGGCGGGAGGCGGGGTCCGAGTCACCGCCTGCCGCCGCGCCCCCGGTTTCTATAAATTGAGC",
>>>
>>>
"nr/nt")
>
> the database is "nr", not "nr/nt"; it seems like the code isn't checking the
> result for an error, just not finding any results.
>
> Martin
>
>> list()
>>
>> I think my issue is I don't understand the format of the database
>> argument, because I can provide nonsense names for the database, and it
>> doesn't give an error for those. The help file doesn't contain enough
>> detail. Can the documentation be clarified ?
>>
>> I am also interested in the argument "filter" for which there is only a
>> blank space.
>>
>> -------------------------------------- Dario Strbenac PhD Student
>> University of Sydney Camperdown NSW 2050 Australia
>>
>> _______________________________________________ Bioconductor mailing list
>> Bioconductor at r-project.org
>> https://stat.ethz.ch/mailman/listinfo/bioconductor Search the archives:
>> http://news.gmane.org/gmane.science.biology.informatics.conductor
>>
>
>
> -- Computational Biology / Fred Hutchinson Cancer Research Center 1100
> Fairview Ave. N. PO Box 19024 Seattle, WA 98109
>
> Location: Arnold Building M1 B861 Phone: (206) 667-2793
>
>
> _______________________________________________ Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor
>


-- 
Computational Biology / Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N.
PO Box 19024 Seattle, WA 98109

Location: Arnold Building M1 B861
Phone: (206) 667-2793