[BioC] Annotate blastSequences Returns No Result

[Dario Strbenac]

Thanks. That worked, although there is no description or score returned with the results. It must still be at an early stage of development, which I wasn't expecting in the release branch of a package.

________________________________________
From: Martin Morgan [mtmorgan at fhcrc.org]
Sent: Monday, 19 August 2013 12:07 AM
To: Dario Strbenac
Cc: bioconductor at r-project.org
Subject: Re: [BioC] Annotate blastSequences Returns No Result

On 08/18/2013 02:00 AM, Dario Strbenac wrote:
> Hello,
>
> The function blastSequences in the package Annotate isn't returning anything
> for the following example, a sequence from the beginning of GAPDH in the
> human genome reference sequence.
>
>> blastSequences("TGGGACTGGCTGAGCCTGGCGGGAGGCGGGGTCCGAGTCACCGCCTGCCGCCGCGCCCCCGGTTTCTATAAATTGAGC",
>> "nr/nt")

the database is "nr", not "nr/nt"; it seems like the code isn't checking the
result for an error, just not finding any results.

Martin

> list()
>
> I think my issue is I don't understand the format of the database argument,
> because I can provide nonsense names for the database, and it doesn't give an
> error for those. The help file doesn't contain enough detail. Can the
> documentation be clarified ?
>
> I am also interested in the argument "filter" for which there is only a blank
> space.
>
> -------------------------------------- Dario Strbenac PhD Student University
> of Sydney Camperdown NSW 2050 Australia
>
> _______________________________________________ Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor
>


--
Computational Biology / Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N.
PO Box 19024 Seattle, WA 98109

Location: Arnold Building M1 B861
Phone: (206) 667-2793