[BioC] Definition of probes in lumiHumanAll annotation database

[Javier Pérez Florido]

Thanks,
I meant information such as:
Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 
2, mRNA.
Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 
1, mRNA.
Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 
3, mRNA.

Since the gene A1CF has three different probes each one related to a 
given transcript variant. Don't know how to find the above information 
through either illuminaHumanv4.db or lumiHumanAll.db annotation packages.

Thanks,
Javier



On 02/04/2012 12:11, Mark Dunning wrote:
> Hi Javier,
>
> I'm afraid I'm not clear about what you mean by probe definitions.
> Rather than being Refseq-centric, the illuminaHumanv1.db,
> illuminaHumanv2.db, illuminaHumanv3.db, illuminaHumanv4.db packages
> provide an interface to individual probe sequences and quality
> information, if this is helpful?
>
> probes<- unlist(mget("A1CF", revmap(illuminaHumanv4SYMBOL)))
>
>> probes
>           A1CF1          A1CF2          A1CF3
> "ILMN_1779670" "ILMN_1806310" "ILMN_2383229"
>
>>   mget(probes, illuminaHumanv4PROBESEQUENCE)
> $ILMN_1779670
> [1] "GGCACATGCCCAGAGCCAGAAGCGAGCATGAGCACAGCAATTCCTGGCCT"
>
> $ILMN_1806310
> [1] "GAGGTCTACCCAACTTTTGCAGTGACTGCCCGAGGGGATGGATATGGCAC"
>
> $ILMN_2383229
> [1] "TGCTGTCCCTAATGCAACTGCACCCGTGTCTGCAGCCCAGCTCAAGCAAG"
>
>>   mget(probes, illuminaHumanv4GENOMICLOCATION)
> $ILMN_1779670
> [1] "chr10:52610480:52610529:-"
>
> $ILMN_1806310
> [1] "chr10:52566496:52566545:-"
>
> $ILMN_2383229
> [1] "chr10:52566587:52566636:-"
>
> Regards,
>
> Mark
>
> 2012/4/2 Javier Pérez Florido<jpflorido at gmail.com>:
>> Dear list,
>> I've checked all the annotation elements given by lumiHumanAll.db and, as
>> far as I know, none of them provides the definition of probes. If I'm not
>> wrong, this definition can distinguishes isoforms and other factors.
>> How can I get such information from the lumiHumanAll annotation file? For
>> example, gene A1CF has three different probes, corresponding each one to a
>> different transcript variant, but I cannot obtain such information from the
>> lumiHumanAll database.
>>
>> Thanks,
>> Javier
>>
>> _______________________________________________
>> Bioconductor mailing list
>> Bioconductor at r-project.org
>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>> Search the archives:
>> http://news.gmane.org/gmane.science.biology.informatics.conductor