[BioC] Definition of probes in lumiHumanAll annotation database

[Mark Dunning]

Hi Javier,

I'm afraid I'm not clear about what you mean by probe definitions.
Rather than being Refseq-centric, the illuminaHumanv1.db,
illuminaHumanv2.db, illuminaHumanv3.db, illuminaHumanv4.db packages
provide an interface to individual probe sequences and quality
information, if this is helpful?

probes <- unlist(mget("A1CF", revmap(illuminaHumanv4SYMBOL)))

> probes
         A1CF1          A1CF2          A1CF3
"ILMN_1779670" "ILMN_1806310" "ILMN_2383229"

>  mget(probes, illuminaHumanv4PROBESEQUENCE)
$ILMN_1779670
[1] "GGCACATGCCCAGAGCCAGAAGCGAGCATGAGCACAGCAATTCCTGGCCT"

$ILMN_1806310
[1] "GAGGTCTACCCAACTTTTGCAGTGACTGCCCGAGGGGATGGATATGGCAC"

$ILMN_2383229
[1] "TGCTGTCCCTAATGCAACTGCACCCGTGTCTGCAGCCCAGCTCAAGCAAG"

>  mget(probes, illuminaHumanv4GENOMICLOCATION)
$ILMN_1779670
[1] "chr10:52610480:52610529:-"

$ILMN_1806310
[1] "chr10:52566496:52566545:-"

$ILMN_2383229
[1] "chr10:52566587:52566636:-"

Regards,

Mark

2012/4/2 Javier Pérez Florido <jpflorido at gmail.com>:
> Dear list,
> I've checked all the annotation elements given by lumiHumanAll.db and, as
> far as I know, none of them provides the definition of probes. If I'm not
> wrong, this definition can distinguishes isoforms and other factors.
> How can I get such information from the lumiHumanAll annotation file? For
> example, gene A1CF has three different probes, corresponding each one to a
> different transcript variant, but I cannot obtain such information from the
> lumiHumanAll database.
>
> Thanks,
> Javier
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor