[BioC] edgeR: error in readDGE

[Wolfgang Huber]

村田 卓也,

It looks like the second column ("COUNT") in your files is not always 
numeric. Can you send the output of the following:

for (f in targets$files)
   str(read.delim(f, stringsAsFactors=FALSE))


Best wishes
	Wolfgang

Il Nov/10/10 9:36 AM, 村田 卓也 ha scritto:
> I am a beginner of everything of R and edgeR; just like "copy and paste of the command" of the manual.
>
> I tried to make DGEList object like descriptions on page 9.
> I could make object, "target", as follows.
>> targets
>     files group description
> 1 GAT.txt    MT         FT9
> 2 ACA.txt    WT         FT9
> 3 ACT.txt    MT        FT10
> 4 ACG.txt    WT        FT10
>
> On the next command, I failed.
> d<- readDGE(targets)
>
> (I deleted "skip = 5, comment.char = "#"" from original command, because on my understanding,
> there were no rows to be skipped, nor comments.)
>
> error colSums(x$counts) :  'x' must be numeric
>
> This error message might be inaccurate, because it is localized.
>
> GAT.txt, and other txt files were made as a tab-delimited, plain-text, as follows, for example.
> SEQUENCE	COUNT
> AAACAGCAGAGAGAGAGAGAGAGAGAG	0
> AAACAGCAGGTACAAGATCTACCCGGG	0
> AAACAGCAGTGTTCTGAAGCCAAACTC	0
> ....
>
> I use R for Mac OSX GUI 1.35 and newest edgeR.
>
> I am very happy, if you have any comments.
> Thank you.
>
> Takuya
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor