[BioC] writing a fasta file in blocks

[Kasper Daniel Hansen]

Doing what Fahim suggests internally in writeFASTA has been on my todo
list for a while, and it will significantly speed up the writing of
fasta files with many small records.  Guess I should do it now, and
cross it off my list.

But Fahim: I am not sure it is possible to do what you want to do with
the current function (at least if you are using Biostrings), but I
could be wrong.  If you want to investigate further, note that the
file can be a connection (?connection).

Kasper

On Tue, Jun 8, 2010 at 4:26 PM, Sean Davis <sdavis2 at mail.nih.gov> wrote:
> On Mon, Jun 7, 2010 at 11:12 PM, Fahim Md <fahim.md at gmail.com> wrote:
>
>> I have a data File, the format of which is given below. It has two fields,
>> namely  sequence and probeset name.
>>    sequence                                       Probe Set Name
>> GCTACTTTACTCCAGAATTTTGTTA      1367452_at.1
>> TTAGAAAGCCGCAATTTGGTCCCGC    1367452_at.2
>> GCCACATCCTGACTACTGCAGTATA     1367452_at.3
>> ............
>> AAAAAAAAGGGGGGGTCCCCCCCC     1234567_at.1
>>
>>
>> Now, I want to convert that into FASTA format as follows
>>
>> >1367452_at.1
>> GCTACTTTACTCCAGAATTTTGTTA
>> >1367452_at.2
>> TTAGAAAGCCGCAATTTGGTCCCGC
>> >1367452_at.3
>> GCCACATCCTGACTACTGCAGTATA
>> .......
>> ....
>> >1234567_at.1
>> AAAAAAAAAAAAACCCCCCCCCCCC
>>
>>
>> I am getting the required output by using writeFASTA(..) function but it is
>> too slow because I am using loop and in every loop it access the file to
>> write into.
>>
>> Is there anyway through which I can write this fasta information into some
>> variable and once I am done I write back that  variable into the required
>> file.
>>
>>
> Hi,Fahim.
>
> Probably most appropriate for here and not bioc-devel.  Perhaps a
> reproducible code example and some sessionInfo() would be helpful.
>
> Sean
>
>        [[alternative HTML version deleted]]
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
>