[BioC] xmapcore get intronic sequence
Stephen Taylor
stephen.taylor at imm.ox.ac.uk
Wed Jul 28 16:39:52 CEST 2010
Hi Tim,
> No, we currently only store the sequence information for exons
Fair enough...
>
> However, I have a site which should allow you to look up that information:
>
> http://xmap.picr.man.ac.uk/sequence/
>
> You should be able to entr your region of interest, and click "View Below"
>
Thanks. I have a lot of probesetids so I'll probably use BioStrings as Vincent suggested or Bio::Ensembl.
On a related note, if do
probeset.to.exon(probesetids),
then I get less rows returned than the size of the probesetids list, I presume because they don't map to known exons.
Since I want to merge this with an existing dataframe that contains the probesetids and expression values, I really need
it to return a value (FALSE or NA or something) where there is no match so I can do this merge. Is there a way of doing
this?
Thanks,
Steve
> Cheers,
>
> Tim
>
> On 28/07/2010 14:25, "Stephen Taylor"<stephen.taylor at imm.ox.ac.uk> wrote:
>
>> Hi,
>>
>> Is there a method in xmapcore to get part of the sequence of the adjoining
>> intron given an exon id?
>>
>> For example:
>>
>>> exon.details("ENSE00001146308")
>> RangedData with 1 row and 5 value columns across 1 space
>> space ranges | stable_id strand phase
>> <character> <IRanges> |<character> <integer> <integer>
>> 1 17 [7590695, 7590856] | ENSE00001146308 -1 -1
>> end_phase
>> <integer>
>> 1 -1
>>
>> sequence
>>
>> <character>
>> 1
>> GTTTTCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTTTGAGCTTCTCAAAAGTCTAGAGCCACCGTCCAGGGAG
>> CAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTGCTTTCCACGACGGTGACACGCTTCCCTG
>> GATTGG
>>
>>
>> I'd like to get chr17:7590695-7590863
>>
>> Thanks,
>>
>> Steve
>>
>> _______________________________________________
>> Bioconductor mailing list
>> Bioconductor at stat.math.ethz.ch
>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>> Search the archives:
>> http://news.gmane.org/gmane.science.biology.informatics.conductor
>
More information about the Bioconductor
mailing list