[BioC] xmapcore get intronic sequence
Tim Yates
TYates at picr.man.ac.uk
Wed Jul 28 16:22:48 CEST 2010
Hi Steve,
No, we currently only store the sequence information for exons
However, I have a site which should allow you to look up that information:
http://xmap.picr.man.ac.uk/sequence/
You should be able to entr your region of interest, and click "View Below"
Cheers,
Tim
On 28/07/2010 14:25, "Stephen Taylor" <stephen.taylor at imm.ox.ac.uk> wrote:
> Hi,
>
> Is there a method in xmapcore to get part of the sequence of the adjoining
> intron given an exon id?
>
> For example:
>
>> exon.details("ENSE00001146308")
> RangedData with 1 row and 5 value columns across 1 space
> space ranges | stable_id strand phase
> <character> <IRanges> | <character> <integer> <integer>
> 1 17 [7590695, 7590856] | ENSE00001146308 -1 -1
> end_phase
> <integer>
> 1 -1
>
> sequence
>
> <character>
> 1
> GTTTTCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTTTGAGCTTCTCAAAAGTCTAGAGCCACCGTCCAGGGAG
> CAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTGCTTTCCACGACGGTGACACGCTTCCCTG
> GATTGG
>
>
> I'd like to get chr17:7590695-7590863
>
> Thanks,
>
> Steve
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor
More information about the Bioconductor
mailing list