[BioC] xmapcore get intronic sequence

[Tim Yates]

Hi Steve,

No, we currently only store the sequence information for exons

However, I have a site which should allow you to look up that information:

http://xmap.picr.man.ac.uk/sequence/

You should be able to entr your region of interest, and click "View Below"

Cheers,

Tim

On 28/07/2010 14:25, "Stephen Taylor" <stephen.taylor at imm.ox.ac.uk> wrote:

> Hi,
> 
> Is there a method in xmapcore to get part of the sequence of the adjoining
> intron given an exon id?
> 
> For example:
> 
>> exon.details("ENSE00001146308")
> RangedData with 1 row and 5 value columns across 1 space
>          space             ranges |       stable_id    strand     phase
>    <character>          <IRanges> |     <character> <integer> <integer>
> 1          17 [7590695, 7590856] | ENSE00001146308        -1        -1
>    end_phase
>    <integer>
> 1        -1
>  
>                                       sequence
>  
>                                    <character>
> 1 
> GTTTTCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTTTGAGCTTCTCAAAAGTCTAGAGCCACCGTCCAGGGAG
> CAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTGCTTTCCACGACGGTGACACGCTTCCCTG
> GATTGG
> 
> 
> I'd like to get chr17:7590695-7590863
> 
> Thanks,
> 
> Steve
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor