[BioC] Annotate getSEQ weird behaviour.

Wed Dec 22 17:54:15 CET 2010

On 12/21/2010 08:40 PM, Giulio Di Giovanni wrote:
> 
> Maybe it's only a temporary thing, but if I follow the help
> 
> 
>> library(annotate)
> Loading required package: AnnotationDbi
> Loading required package: Biobase
> 
> Welcome to Bioconductor
> 
>   Vignettes contain introductory material. To view, type
>   'openVignette()'. To cite Bioconductor, see
>   'citation("Biobase")' and for packages 'citation(pkgname)'.
> 
>> getSEQ("M22490")
> [1] "<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Transitional//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd\"><html xmlns=\"http://www.w3.org/1999/xhtml\">    <head xmlns:xi=\"http://www.w3.org/2001/XInclude\">    <!-- meta -->     <meta name=\"ncbi_app\" content=\"entrez\" /><meta name=\"ncbi_db\" content=\"nuccore\" /><meta name=\"ncbi_report\" content=\"fasta\" /><meta name=\"ncbi_format\" content=\"html\" /><meta name=\"ncbi_pagesize\" content=\"20\" /><meta na... etc etc etc
> Warning message:
> In readLines(paste("http://www.ncbi.nlm.nih.gov/entrez/batchseq.cgi?",  :
>   incomplete final line found on 'http://www.ncbi.nlm.nih.gov/entrez/batchseq.cgi?cmd=&txt=on&save=&cfm=&list_uids=M22490&db=nucleotide&extrafeat=16&term=&view=fasta&dispmax=20&SendTo=t&__from=&__to=&__strand='
>>
>>
> 
> 
> This it's weird, since only 3 days ago it was working perfectly.

Hi Giulio -- no problems on my end; maybe your R or Bioconductor
packages are out of date? More esoteric, but maybe encoding is an issue
(?Sys.getlocale)?

Martin

> substr(getSEQ("M22490"), 1, 40)
[1] "GGCAGAGGAGGAGGGAGGGAGGGAAGGAGCGCGGAGCCCG"
> sessionInfo()
R version 2.12.0 Patched (2010-11-21 r53647)
Platform: x86_64-unknown-linux-gnu (64-bit)

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C
 [3] LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8
 [5] LC_MONETARY=C              LC_MESSAGES=en_US.UTF-8
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C
 [9] LC_ADDRESS=C               LC_TELEPHONE=C
[11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base

other attached packages:
[1] annotate_1.28.0      AnnotationDbi_1.12.0 Biobase_2.10.0

loaded via a namespace (and not attached):
[1] DBI_0.2-5     RSQLite_0.9-4 xtable_1.5-6

> 
> Any hints? NCBI changed the format of their entries and annotate package has still to be updated? Maybe it's me? my connection?
> Any suggestion will be appreciated, I really need it working with no errors now...
> 
> Best,
> 
> G
>  		 	   		  
> 	[[alternative HTML version deleted]]
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor

-- 
Computational Biology
Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109

Location: M1-B861
Telephone: 206 667-2793