[BioC] problem using Alternative CDF environments, CdfEnvAffy

[Martin Morgan]

Hi Vincent --

On 04/05/2010 07:57 PM, Vincent Davis wrote:
> I very new to R and having a little trouble with CdfEnvAffy, I am going
> thought the

Might help to read through

  http://cran.fhcrc.org/doc/manuals/R-intro.html

(also available by typing help.start() in to your R session).

> Here are my steps
>> fasta.filename <- system.file("/Users/vmd/Dropbox/dna/toxodb/",
> "TgondiiME49Genomic_ToxoDB-6.0.fasta", package = "altcdfenvs")
>> con <- file(fasta.filename, open = "r")
> Warning message:
> In file(fasta.filename, open = "r") :
>   file("") only supports open = "w+" and open = "w+b": using the former
> 
> #### Not sure what to do about this error so I just removed, <open = "r">,
> this seems to be ok
> 
>> con <- file(fasta.filename)
> 
> #### This is where I am really stuck
> 
>> while (!is.null(fasta.seq$header)) {print(fasta.seq) fasta.seq <-
> read.FASTA.entry(con)}
> Error: unexpected symbol in "while (!is.null(fasta.seq$header))
> {print(fasta.seq) fasta.seq"

This is saying that you cannot write

  print(fasta.seq) fasta.seq <- read.FASTA.entry(con)

on a single line -- it is a syntax error and would normally be written
on two separate lines

  while (!is.null(fastq.seq$header)) {
     print(fasta.seq)
     fasta.seq <- read.FASTA.entry(con)
  }

Martin

> #### So I tried this and it is better but still not right
>> while (!is.null(fasta.seq$header)) {print(fasta.seq) (fasta.seq <-
> read.FASTA.entry(con))}
> FASTA sequence:
>    >gnl|UG|Hs#S1730546 membrane-spanning 4-domains, subfamily A ...
>    AACCCATTTCAACTGCCTATTCAGAGCATGCAGTAAGAGGAAATCCACCAAGTCTCAATA ...
> Error: attempt to apply non-function
> 
> 
> So I am not sure how to get this to work.
> Thanks
> Vincent
> 
> 
>> sessionInfo()
> R version 2.10.1 (2009-12-14)
> x86_64-apple-darwin9.8.0
> 
> locale:
> [1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8
> 
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods   base
> 
> other attached packages:
>  [1] altcdfenvs_2.8.0    hypergraph_1.18.0   graph_1.24.4
>  makecdfenv_1.24.0   affyio_1.14.0
>  [6] matchprobes_1.18.0  Biostrings_2.14.12  IRanges_1.4.16
>  AnnotationDbi_1.8.2 affy_1.24.2
> [11] Biobase_2.6.1
> 
> loaded via a namespace (and not attached):
> [1] DBI_0.2-5            preprocessCore_1.8.0 RSQLite_0.8-4
>  tools_2.10.1
> 
> 
> 
>   *Vincent Davis
> 720-301-3003 *
> vincent at vincentdavis.net
>  my blog <http://vincentdavis.net> |
> LinkedIn<http://www.linkedin.com/in/vincentdavis>
> 
> 	[[alternative HTML version deleted]]
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor


-- 
Martin Morgan
Computational Biology / Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N.
PO Box 19024 Seattle, WA 98109

Location: Arnold Building M1 B861
Phone: (206) 667-2793