[BioC] Genome position to miRNA or gene name

[Daniel Brewer]

Hello,

I have got a set of human genome locations that I have found using
Biostrings and BSGenome alignment e.g.

seqname	start	        end	        strand	patternID
chr9	95978065	95978085	+	TGAGGTAGTAGGTTGTATAGT
chr11	121522487	121522507	-	TGAGGTAGTAGGTTGTATAGT
chr22	44887296	44887316	+	TGAGGTAGTAGGTTGTATAGT
chr22	44888235	44888256	+	TGAGGTAGTAGGTTGTGTGGTT

What I would like to know is whether this genome location is within a
known miRNA or gene.  What would the best way be to go about this?

Many thanks

Dan
-- 
**************************************************************
Daniel Brewer, Ph.D.

Institute of Cancer Research
Molecular Carcinogenesis
Email: daniel.brewer at icr.ac.uk
**************************************************************

The Institute of Cancer Research: Royal Cancer Hospital, a charitable Company Limited by Guarantee, Registered in England under Company No. 534147 with its Registered Office at 123 Old Brompton Road, London SW7 3RP.

This e-mail message is confidential and for use by the a...{{dropped:2}}