[BioC] [biocpkgs] suggestions on package matchprobes

[Wolfgang Huber]

Hi Xinxia,

thanks!
1. The problem with the cases was simple: the function 'matchprobes'
calls C code to do the actual work, and it was:

  matchprobes <- function(query, records, probepos=FALSE)
     .Call("MP_matchprobes", toupper(query), records, probepos,
         PACKAGE="matchprobes")

I removed the "toupper" in matchprobes_1.5.1, this should make you
happier. There is no good reason why it should have been there, and that
it was not documented was a bug. So now it is gone.

2. As Robert said, for generic sequence matching please use
"Biostrings", that is much better. "matchprobes" only still exists for
backward compatibility.

 Best wishes
 Wolfgang


Robert Gentleman wrote:
> Please ask these sorts of questions on the Bioconductor mailing list - 
> redirected there
> 
> and for generic sequence matching Biostrings is a better tool -
> we will look into this,
> thanks
> Robert
> 
> Xinxia Peng wrote:
>> =+=+=+=+=+=+=+=+=+ biocpkgs mailing list +=+=+=+=+=+=+=+=+=
>> Dear Bioc Team,
>>
>> It appears that the function 'matchprobes' will not work with sequences in lower case. Also it might be nice not to match empty string. See the following example:
>>
>>
>>> test.seq
>>  [1] "atggcggcgcaaagtagtggtgggggtggaggttgtggtgaggaagataaagatgccaaatatatgtttgataggatagggaaagaagtgcacgacgaag"
>>  [2] "atgaaaagggtaatgcaacaatttgtggatcgtacaacacaacgatttcacgaatatgatgaaaggatgaaaactacacgccaaaaatgtaaagaacgat"
>>  [3] "atgaaacttcactgctctaaaatattattatttttacttccattaaatatattagtaacatcattatcaaatgtgcataataataataaactatacaaca"
>>  [4] "atgaaagtccattatattaatatattattgtttgctcttccattaaatatattggaacataataaaaatgaaccacacaccacaccaaatcatacacaaa"
>>  [5] "atgtttacaacaaaaaaaaaaattaaatatattataattatatgtggcatctttcgaaaatatttcaaattcggaagaattattgaggttccaatgatgc"
>>  [6] "atgaaactgcactactctaatatattattatttttctttccattaaatatattagtaacatcatatcatgtatataataaaaataaaatatacatcacac"
>>  [7] "atgtgtgctattggagaattactatcatctacagataaggaatatactcttaatttctttggtttagttaaagatggagcatcgattgatgaaatgaaag"
>>  [8] "atgattaagatgaaattccattatgtaggatattattctgaagaagaaaatatgaaaaatacactgaaaatttgttccgttagacaaatatttttaaatt"
>>  [9] "atgttattatttgctttattatttaatgcacttttattatcacaaaatgtaaattgccgaaacaacaattataatataagattcactcaaacgataacac"
>> [10] "atgatataccacagaaggattatagcttatctcataaatcatctaccattaggtatatcccttacagaagtggtcgatataaatgaagaacatatattta"
>>> test.p
>> [1] "atggcggcgcaaagtagtggtgggg"
>>> matchprobes(test.seq, test.p)
>> $match
>> $match[[1]]
>> numeric(0)
>>
>> $match[[2]]
>> numeric(0)
>>
>> $match[[3]]
>> numeric(0)
>>
>> $match[[4]]
>> numeric(0)
>>
>> $match[[5]]
>> numeric(0)
>>
>> $match[[6]]
>> numeric(0)
>>
>> $match[[7]]
>> numeric(0)
>>
>> $match[[8]]
>> numeric(0)
>>
>> $match[[9]]
>> numeric(0)
>>
>> $match[[10]]
>> numeric(0)
>>
>>> matchprobes(toupper(test.seq), toupper(c(test.p, "")))
>> $match
>> $match[[1]]
>> [1] 1 2
>>
>> $match[[2]]
>> [1] 2
>>
>> $match[[3]]
>> [1] 2
>>
>> $match[[4]]
>> [1] 2
>>
>> $match[[5]]
>> [1] 2
>>
>> $match[[6]]
>> [1] 2
>>
>> $match[[7]]
>> [1] 2
>>
>> $match[[8]]
>> [1] 2
>>
>> $match[[9]]
>> [1] 2
>>
>> $match[[10]]
>> [1] 2
>>
>>
>> Thanks,
>> Xinxia Peng
>> Seattle Biomedical Research Institute
>>
>>
>>
>> __________________________________________________________________
>> biocpkgs mailing list
>> To unsubscribe from this mailing list send a blank email to
>> biocpkgs-leave at lists.fhcrc.org
>> You can also unsubscribe or change your personal options at
>> http://lists.fhcrc.org/mailman/listinfo/biocpkgs
> 


-- 
------------------------------------------------------------------
Wolfgang Huber  EBI/EMBL  Cambridge UK  http://www.ebi.ac.uk/huber