[BioC] [biocpkgs] suggestions on package matchprobes

[Robert Gentleman]

Please ask these sorts of questions on the Bioconductor mailing list - 
redirected there

and for generic sequence matching Biostrings is a better tool -
we will look into this,
thanks
Robert

Xinxia Peng wrote:
> =+=+=+=+=+=+=+=+=+ biocpkgs mailing list +=+=+=+=+=+=+=+=+=
> Dear Bioc Team,
> 
> It appears that the function 'matchprobes' will not work with sequences in lower case. Also it might be nice not to match empty string. See the following example:
> 
> 
>> test.seq
>  [1] "atggcggcgcaaagtagtggtgggggtggaggttgtggtgaggaagataaagatgccaaatatatgtttgataggatagggaaagaagtgcacgacgaag"
>  [2] "atgaaaagggtaatgcaacaatttgtggatcgtacaacacaacgatttcacgaatatgatgaaaggatgaaaactacacgccaaaaatgtaaagaacgat"
>  [3] "atgaaacttcactgctctaaaatattattatttttacttccattaaatatattagtaacatcattatcaaatgtgcataataataataaactatacaaca"
>  [4] "atgaaagtccattatattaatatattattgtttgctcttccattaaatatattggaacataataaaaatgaaccacacaccacaccaaatcatacacaaa"
>  [5] "atgtttacaacaaaaaaaaaaattaaatatattataattatatgtggcatctttcgaaaatatttcaaattcggaagaattattgaggttccaatgatgc"
>  [6] "atgaaactgcactactctaatatattattatttttctttccattaaatatattagtaacatcatatcatgtatataataaaaataaaatatacatcacac"
>  [7] "atgtgtgctattggagaattactatcatctacagataaggaatatactcttaatttctttggtttagttaaagatggagcatcgattgatgaaatgaaag"
>  [8] "atgattaagatgaaattccattatgtaggatattattctgaagaagaaaatatgaaaaatacactgaaaatttgttccgttagacaaatatttttaaatt"
>  [9] "atgttattatttgctttattatttaatgcacttttattatcacaaaatgtaaattgccgaaacaacaattataatataagattcactcaaacgataacac"
> [10] "atgatataccacagaaggattatagcttatctcataaatcatctaccattaggtatatcccttacagaagtggtcgatataaatgaagaacatatattta"
>> test.p
> [1] "atggcggcgcaaagtagtggtgggg"
>> matchprobes(test.seq, test.p)
> $match
> $match[[1]]
> numeric(0)
> 
> $match[[2]]
> numeric(0)
> 
> $match[[3]]
> numeric(0)
> 
> $match[[4]]
> numeric(0)
> 
> $match[[5]]
> numeric(0)
> 
> $match[[6]]
> numeric(0)
> 
> $match[[7]]
> numeric(0)
> 
> $match[[8]]
> numeric(0)
> 
> $match[[9]]
> numeric(0)
> 
> $match[[10]]
> numeric(0)
> 
>> matchprobes(toupper(test.seq), toupper(c(test.p, "")))
> $match
> $match[[1]]
> [1] 1 2
> 
> $match[[2]]
> [1] 2
> 
> $match[[3]]
> [1] 2
> 
> $match[[4]]
> [1] 2
> 
> $match[[5]]
> [1] 2
> 
> $match[[6]]
> [1] 2
> 
> $match[[7]]
> [1] 2
> 
> $match[[8]]
> [1] 2
> 
> $match[[9]]
> [1] 2
> 
> $match[[10]]
> [1] 2
> 
> 
> Thanks,
> Xinxia Peng
> Seattle Biomedical Research Institute
> 
> 
> 
> __________________________________________________________________
> biocpkgs mailing list
> To unsubscribe from this mailing list send a blank email to
> biocpkgs-leave at lists.fhcrc.org
> You can also unsubscribe or change your personal options at
> http://lists.fhcrc.org/mailman/listinfo/biocpkgs

-- 
Robert Gentleman, PhD
Program in Computational Biology
Division of Public Health Sciences
Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N, M2-B876
PO Box 19024
Seattle, Washington 98109-1024
206-667-7700
rgentlem at fhcrc.org