[BioC] probe level annotation

Shi, Tao shidaxia at yahoo.com
Mon Oct 2 23:08:13 CEST 2006


Hi Holger,

If that's the case, how do you match them up?  Thanks,

...Tao



+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
Hi Tao,

at least for the Plus2 and the X3P chip, the order of hgu133plus2probe and pm(...) slightly differ.

Best,
Holger


-------- Original-Nachricht --------
Datum: Mon, 2 Oct 2006 13:53:00 -0700 (PDT)
Von: "Shi, Tao" <shidaxia at yahoo.com>
An: "James W. MacDonald" <jmacdon at med.umich.edu>
Betreff: Re: [BioC] probe level annotation

> Hi Jim,
> 
> Thanks!  My bad.  I accidentally selected the HT 133A array.
> 
> Any idea on my second question?  I assume they are listed in the same
> order, but not sure whether it's right.
> 
> ...Tao
> 
> 
> 
> 
> ----- Original Message ----
> From: James W. MacDonald <jmacdon at med.umich.edu>
> To: "Shi, Tao" <shidaxia at yahoo.com>
> Cc: bioconductor at stat.math.ethz.ch
> Sent: Monday, October 2, 2006 1:36:35 PM
> Subject: Re: [BioC] probe level annotation
> 
> Hi Tao,
> 
> 
> 
> I just checked netaffx, and I get the same as the hgu133aprobe and 
> 
> hgu133acdf show:
> 
> 
> 
> CACCCAGCTGGTCCTGTGGATGGGA      467      181      3330      Antisense
> 
> GCCCCACTGGACAACACTGATTCCT     531     299     3443     Antisense
> 
> TGGACCCCACTGGCTGAGAATCTGG     86     557     3512     Antisense
> 
> AAATGTTTCCTTGTGCCTGCTCCTG     365     115     3563     Antisense
> 
> TCCTTGTGCCTGCTCCTGTACTTGT     207     605     3570     Antisense
> 
> TGCCTGCTCCTGTACTTGTCCTCAG     593     599     3576     Antisense
> 
> TCCTGTACTTGTCCTCAGCTTGGGC     425     607     3583     Antisense
> 
> ACTTGTCCTCAGCTTGGGCTTCTTC     552     101     3589     Antisense
> 
> TCCTCCATCACCTGAAACACTGGAC     680     607     3615     Antisense
> 
> AAGCCTATACGTTTCTGTGGAGTAA     532     139     3713     Antisense
> 
> TTGGACATCTCTAGTGTAGCTGCCA     143     709     3786     Antisense
> 
> TCTCTAGTGTAGCTGCCACATTGAT     285     623     3793     Antisense
> 
> GTGTAGCTGCCACATTGATTTTTCT     383     479     3799     Antisense
> 
> GCCACATTGATTTTTCTATAATCAC     129     279     3807     Antisense
> 
> TACACTAATATATGGACCTAGCTTG     62     651     3871     Antisense
> 
> ATATATGGACCTAGCTTGAGGCAAT     308     15     3878     Antisense
> 
> 
> 
> No idea why you got something different.
> 
> 
> 
> Best,
> 
> 
> 
> Jim
> 
> 
> 
> 
> 
> 
> 
> 
> 
> 
> 
> Shi, Tao wrote:
> 
> > Hi list,
> 
> > 
> 
> > I found the XY coordinates for the probes in 'hgu133aprobe' are not
> exactly the same as those shown on NetAffx.com.  Please see below.
> 
> > 
> 
> > Also, is the order of the probes from pm(myAffyData, '1007_s_at'), for
> examples, the same as in 'hgu133aprobe'? 
> 
> > 
> 
> > thanks,
> 
> > 
> 
> > ...Tao
> 
> > 
> 
> > 
> 
> > 
> 
> >>R.Version()
> 
> > 
> 
> > $platform
> 
> > [1] "i386-pc-mingw32"
> 
> > 
> 
> > $arch
> 
> > [1] "i386"
> 
> > 
> 
> > $os
> 
> > [1] "mingw32"
> 
> > 
> 
> > $system
> 
> > [1] "i386, mingw32"
> 
> > 
> 
> > $status
> 
> > [1] ""
> 
> > 
> 
> > $major
> 
> > [1] "2"
> 
> > 
> 
> > $minor
> 
> > [1] "3.0"
> 
> > 
> 
> > $year
> 
> > [1] "2006"
> 
> > 
> 
> > $month
> 
> > [1] "04"
> 
> > 
> 
> > $day
> 
> > [1] "24"
> 
> > 
> 
> > $`svn rev`
> 
> > [1] "37909"
> 
> > 
> 
> > $language
> 
> > [1] "R"
> 
> > 
> 
> > $version.string
> 
> > [1] "Version 2.3.0 (2006-04-24)"
> 
> > 
> 
> > 
> 
> >>library(hgu133aprobe)
> 
> >>data(hgu133aprobe)
> 
> >>as.data.frame(hgu133aprobe[1:16,])
> 
> > 
> 
> >                     sequence   x   y Probe.Set.Name
> Probe.Interrogation.Position Target.Strandedness
> 
> > 1  CACCCAGCTGGTCCTGTGGATGGGA 467 181      1007_s_at                     
>    3330           Antisense
> 
> > 2  GCCCCACTGGACAACACTGATTCCT 531 299      1007_s_at                     
>    3443           Antisense
> 
> > 3  TGGACCCCACTGGCTGAGAATCTGG  86 557      1007_s_at                     
>    3512           Antisense
> 
> > 4  AAATGTTTCCTTGTGCCTGCTCCTG 365 115      1007_s_at                     
>    3563           Antisense
> 
> > 5  TCCTTGTGCCTGCTCCTGTACTTGT 207 605      1007_s_at                     
>    3570           Antisense
> 
> > 6  TGCCTGCTCCTGTACTTGTCCTCAG 593 599      1007_s_at                     
>    3576           Antisense
> 
> > 7  TCCTGTACTTGTCCTCAGCTTGGGC 425 607      1007_s_at                     
>    3583           Antisense
> 
> > 8  ACTTGTCCTCAGCTTGGGCTTCTTC 552 101      1007_s_at                     
>    3589           Antisense
> 
> > 9  TCCTCCATCACCTGAAACACTGGAC 680 607      1007_s_at                     
>    3615           Antisense
> 
> > 10 AAGCCTATACGTTTCTGTGGAGTAA 532 139      1007_s_at                     
>    3713           Antisense
> 
> > 11 TTGGACATCTCTAGTGTAGCTGCCA 143 709      1007_s_at                     
>    3786           Antisense
> 
> > 12 TCTCTAGTGTAGCTGCCACATTGAT 285 623      1007_s_at                     
>    3793           Antisense
> 
> > 13 GTGTAGCTGCCACATTGATTTTTCT 383 479      1007_s_at                     
>    3799           Antisense
> 
> > 14 GCCACATTGATTTTTCTATAATCAC 129 279      1007_s_at                     
>    3807           Antisense
> 
> > 15 TACACTAATATATGGACCTAGCTTG  62 651      1007_s_at                     
>    3871           Antisense
> 
> > 16 ATATATGGACCTAGCTTGAGGCAAT 308  15      1007_s_at                     
>    3878           Antisense
> 
> > 
> 
> >>package.version('hgu133aprobe')
> 
> > 
> 
> > [1] "1.12.0"
> 
> > 
> 
> > 
> 
> > And from NetAffx.com
> 
> > 
> 
> > Probe Sequence(5'-3')        Probe X        Probe Y        Probe
> Interrogation
> 
> > Position     Target Strandedness
> 
> > CACCCAGCTGGTCCTGTGGATGGGA     197     207     3330     Antisense
> 
> > GCCCCACTGGACAACACTGATTCCT     592     319     3443     Antisense
> 
> > TGGACCCCACTGGCTGAGAATCTGG     85     591     3512     Antisense
> 
> > AAATGTTTCCTTGTGCCTGCTCCTG     559     139     3563     Antisense
> 
> > TCCTTGTGCCTGCTCCTGTACTTGT     269     633     3570     Antisense
> 
> > TGCCTGCTCCTGTACTTGTCCTCAG     378     629     3576     Antisense
> 
> > TCCTGTACTTGTCCTCAGCTTGGGC     536     643     3583     Antisense
> 
> > ACTTGTCCTCAGCTTGGGCTTCTTC     479     125     3589     Antisense
> 
> > TCCTCCATCACCTGAAACACTGGAC     575     643     3615     Antisense
> 
> > AAGCCTATACGTTTCTGTGGAGTAA     497     161     3713     Antisense
> 
> > TTGGACATCTCTAGTGTAGCTGCCA     635     739     3786     Antisense
> 
> > TCTCTAGTGTAGCTGCCACATTGAT     74     659     3793     Antisense
> 
> > GTGTAGCTGCCACATTGATTTTTCT     660     503     3799     Antisense
> 
> > GCCACATTGATTTTTCTATAATCAC     80     313     3807     Antisense
> 
> > TACACTAATATATGGACCTAGCTTG     739     685     3871     Antisense
> 
> > ATATATGGACCTAGCTTGAGGCAAT     242     31     3878     Antisense
> 
> > 
> 
> > _______________________________________________
> 
> > Bioconductor mailing list
> 
> > Bioconductor at stat.math.ethz.ch
> 
> > https://stat.ethz.ch/mailman/listinfo/bioconductor
> 
> > Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor
> 
> 
> 
> 
> 
> -- 
> 
> James W. MacDonald, M.S.
> 
> Biostatistician
> 
> Affymetrix and cDNA Microarray Core
> 
> University of Michigan Cancer Center
> 
> 1500 E. Medical Center Drive
> 
> 7410 CCGC
> 
> Ann Arbor MI 48109
> 
> 734-647-5623
> 
> 
> 
> 
> 
> **********************************************************
> 
> Electronic Mail is not secure, may not be read every day, and should not
> be used for urgent or sensitive issues.
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor

--



More information about the Bioconductor mailing list