[BioC] probe level annotation

James W. MacDonald jmacdon at med.umich.edu
Mon Oct 2 23:04:33 CEST 2006


Holger Schwender wrote:
> Hi Tao,
> 
> at least for the Plus2 and the X3P chip, the order of hgu133plus2probe and pm(...) slightly differ.

It depends on what we get from Affy. The probe packages are based on the 
Affymetrix XXX_probe_tab files, which list things out a particular 
order, and the cdfs are based on the cdf files. If Affy happened to list 
things out in the same order for both input files, then things will line 
up. If not, then they won't ;-D


As Holger says, these two are slightly different. I wouldn't be 
surprised if that were true for all the chips (and I wouldn't be 
surprised if some were 100% consistent either...).

Best,

Jim


> 
> Best,
> Holger
> 
> 
> -------- Original-Nachricht --------
> Datum: Mon, 2 Oct 2006 13:53:00 -0700 (PDT)
> Von: "Shi, Tao" <shidaxia at yahoo.com>
> An: "James W. MacDonald" <jmacdon at med.umich.edu>
> Betreff: Re: [BioC] probe level annotation
> 
> 
>>Hi Jim,
>>
>>Thanks!  My bad.  I accidentally selected the HT 133A array.
>>
>>Any idea on my second question?  I assume they are listed in the same
>>order, but not sure whether it's right.
>>
>>...Tao
>>
>>
>>
>>
>>----- Original Message ----
>>From: James W. MacDonald <jmacdon at med.umich.edu>
>>To: "Shi, Tao" <shidaxia at yahoo.com>
>>Cc: bioconductor at stat.math.ethz.ch
>>Sent: Monday, October 2, 2006 1:36:35 PM
>>Subject: Re: [BioC] probe level annotation
>>
>>Hi Tao,
>>
>>
>>
>>I just checked netaffx, and I get the same as the hgu133aprobe and 
>>
>>hgu133acdf show:
>>
>>
>>
>>CACCCAGCTGGTCCTGTGGATGGGA      467      181      3330      Antisense
>>
>>GCCCCACTGGACAACACTGATTCCT     531     299     3443     Antisense
>>
>>TGGACCCCACTGGCTGAGAATCTGG     86     557     3512     Antisense
>>
>>AAATGTTTCCTTGTGCCTGCTCCTG     365     115     3563     Antisense
>>
>>TCCTTGTGCCTGCTCCTGTACTTGT     207     605     3570     Antisense
>>
>>TGCCTGCTCCTGTACTTGTCCTCAG     593     599     3576     Antisense
>>
>>TCCTGTACTTGTCCTCAGCTTGGGC     425     607     3583     Antisense
>>
>>ACTTGTCCTCAGCTTGGGCTTCTTC     552     101     3589     Antisense
>>
>>TCCTCCATCACCTGAAACACTGGAC     680     607     3615     Antisense
>>
>>AAGCCTATACGTTTCTGTGGAGTAA     532     139     3713     Antisense
>>
>>TTGGACATCTCTAGTGTAGCTGCCA     143     709     3786     Antisense
>>
>>TCTCTAGTGTAGCTGCCACATTGAT     285     623     3793     Antisense
>>
>>GTGTAGCTGCCACATTGATTTTTCT     383     479     3799     Antisense
>>
>>GCCACATTGATTTTTCTATAATCAC     129     279     3807     Antisense
>>
>>TACACTAATATATGGACCTAGCTTG     62     651     3871     Antisense
>>
>>ATATATGGACCTAGCTTGAGGCAAT     308     15     3878     Antisense
>>
>>
>>
>>No idea why you got something different.
>>
>>
>>
>>Best,
>>
>>
>>
>>Jim
>>
>>
>>
>>
>>
>>
>>
>>
>>
>>
>>
>>Shi, Tao wrote:
>>
>>
>>>Hi list,
>>
>>>I found the XY coordinates for the probes in 'hgu133aprobe' are not
>>
>>exactly the same as those shown on NetAffx.com.  Please see below.
>>
>>
>>>Also, is the order of the probes from pm(myAffyData, '1007_s_at'), for
>>
>>examples, the same as in 'hgu133aprobe'? 
>>
>>
>>>thanks,
>>
>>>...Tao
>>
>>>>R.Version()
>>
>>>$platform
>>
>>>[1] "i386-pc-mingw32"
>>
>>>$arch
>>
>>>[1] "i386"
>>
>>>$os
>>
>>>[1] "mingw32"
>>
>>>$system
>>
>>>[1] "i386, mingw32"
>>
>>>$status
>>
>>>[1] ""
>>
>>>$major
>>
>>>[1] "2"
>>
>>>$minor
>>
>>>[1] "3.0"
>>
>>>$year
>>
>>>[1] "2006"
>>
>>>$month
>>
>>>[1] "04"
>>
>>>$day
>>
>>>[1] "24"
>>
>>>$`svn rev`
>>
>>>[1] "37909"
>>
>>>$language
>>
>>>[1] "R"
>>
>>>$version.string
>>
>>>[1] "Version 2.3.0 (2006-04-24)"
>>
>>>>library(hgu133aprobe)
>>
>>>>data(hgu133aprobe)
>>
>>>>as.data.frame(hgu133aprobe[1:16,])
>>
>>>                    sequence   x   y Probe.Set.Name
>>
>>Probe.Interrogation.Position Target.Strandedness
>>
>>
>>>1  CACCCAGCTGGTCCTGTGGATGGGA 467 181      1007_s_at                     
>>
>>   3330           Antisense
>>
>>
>>>2  GCCCCACTGGACAACACTGATTCCT 531 299      1007_s_at                     
>>
>>   3443           Antisense
>>
>>
>>>3  TGGACCCCACTGGCTGAGAATCTGG  86 557      1007_s_at                     
>>
>>   3512           Antisense
>>
>>
>>>4  AAATGTTTCCTTGTGCCTGCTCCTG 365 115      1007_s_at                     
>>
>>   3563           Antisense
>>
>>
>>>5  TCCTTGTGCCTGCTCCTGTACTTGT 207 605      1007_s_at                     
>>
>>   3570           Antisense
>>
>>
>>>6  TGCCTGCTCCTGTACTTGTCCTCAG 593 599      1007_s_at                     
>>
>>   3576           Antisense
>>
>>
>>>7  TCCTGTACTTGTCCTCAGCTTGGGC 425 607      1007_s_at                     
>>
>>   3583           Antisense
>>
>>
>>>8  ACTTGTCCTCAGCTTGGGCTTCTTC 552 101      1007_s_at                     
>>
>>   3589           Antisense
>>
>>
>>>9  TCCTCCATCACCTGAAACACTGGAC 680 607      1007_s_at                     
>>
>>   3615           Antisense
>>
>>
>>>10 AAGCCTATACGTTTCTGTGGAGTAA 532 139      1007_s_at                     
>>
>>   3713           Antisense
>>
>>
>>>11 TTGGACATCTCTAGTGTAGCTGCCA 143 709      1007_s_at                     
>>
>>   3786           Antisense
>>
>>
>>>12 TCTCTAGTGTAGCTGCCACATTGAT 285 623      1007_s_at                     
>>
>>   3793           Antisense
>>
>>
>>>13 GTGTAGCTGCCACATTGATTTTTCT 383 479      1007_s_at                     
>>
>>   3799           Antisense
>>
>>
>>>14 GCCACATTGATTTTTCTATAATCAC 129 279      1007_s_at                     
>>
>>   3807           Antisense
>>
>>
>>>15 TACACTAATATATGGACCTAGCTTG  62 651      1007_s_at                     
>>
>>   3871           Antisense
>>
>>
>>>16 ATATATGGACCTAGCTTGAGGCAAT 308  15      1007_s_at                     
>>
>>   3878           Antisense
>>
>>
>>>>package.version('hgu133aprobe')
>>
>>>[1] "1.12.0"
>>
>>>And from NetAffx.com
>>
>>>Probe Sequence(5'-3')        Probe X        Probe Y        Probe
>>
>>Interrogation
>>
>>
>>>Position     Target Strandedness
>>
>>>CACCCAGCTGGTCCTGTGGATGGGA     197     207     3330     Antisense
>>
>>>GCCCCACTGGACAACACTGATTCCT     592     319     3443     Antisense
>>
>>>TGGACCCCACTGGCTGAGAATCTGG     85     591     3512     Antisense
>>
>>>AAATGTTTCCTTGTGCCTGCTCCTG     559     139     3563     Antisense
>>
>>>TCCTTGTGCCTGCTCCTGTACTTGT     269     633     3570     Antisense
>>
>>>TGCCTGCTCCTGTACTTGTCCTCAG     378     629     3576     Antisense
>>
>>>TCCTGTACTTGTCCTCAGCTTGGGC     536     643     3583     Antisense
>>
>>>ACTTGTCCTCAGCTTGGGCTTCTTC     479     125     3589     Antisense
>>
>>>TCCTCCATCACCTGAAACACTGGAC     575     643     3615     Antisense
>>
>>>AAGCCTATACGTTTCTGTGGAGTAA     497     161     3713     Antisense
>>
>>>TTGGACATCTCTAGTGTAGCTGCCA     635     739     3786     Antisense
>>
>>>TCTCTAGTGTAGCTGCCACATTGAT     74     659     3793     Antisense
>>
>>>GTGTAGCTGCCACATTGATTTTTCT     660     503     3799     Antisense
>>
>>>GCCACATTGATTTTTCTATAATCAC     80     313     3807     Antisense
>>
>>>TACACTAATATATGGACCTAGCTTG     739     685     3871     Antisense
>>
>>>ATATATGGACCTAGCTTGAGGCAAT     242     31     3878     Antisense
>>
>>>_______________________________________________
>>
>>>Bioconductor mailing list
>>
>>>Bioconductor at stat.math.ethz.ch
>>
>>>https://stat.ethz.ch/mailman/listinfo/bioconductor
>>
>>>Search the archives:
>>
>>http://news.gmane.org/gmane.science.biology.informatics.conductor
>>
>>
>>
>>
>>
>>-- 
>>
>>James W. MacDonald, M.S.
>>
>>Biostatistician
>>
>>Affymetrix and cDNA Microarray Core
>>
>>University of Michigan Cancer Center
>>
>>1500 E. Medical Center Drive
>>
>>7410 CCGC
>>
>>Ann Arbor MI 48109
>>
>>734-647-5623
>>
>>
>>
>>
>>
>>**********************************************************
>>
>>Electronic Mail is not secure, may not be read every day, and should not
>>be used for urgent or sensitive issues.
>>
>>_______________________________________________
>>Bioconductor mailing list
>>Bioconductor at stat.math.ethz.ch
>>https://stat.ethz.ch/mailman/listinfo/bioconductor
>>Search the archives:
>>http://news.gmane.org/gmane.science.biology.informatics.conductor
> 
> 


-- 
James W. MacDonald, M.S.
Biostatistician
Affymetrix and cDNA Microarray Core
University of Michigan Cancer Center
1500 E. Medical Center Drive
7410 CCGC
Ann Arbor MI 48109
734-647-5623


**********************************************************
Electronic Mail is not secure, may not be read every day, and should not be used for urgent or sensitive issues.



More information about the Bioconductor mailing list