[BioC] Mismatch Sequences

[Zhijin Wu]

The following is from the vignettes of the matchprobe package


2.2 Mismatch sequences for Affymetrix GeneChips
The mismatch sequences are not explicitely stored in the probe packages.
They are implied by the match sequences, by flipping the middle base. This
can be done with the complementSeq.
> mm <- complementSeq(hgu95av2probe$sequence, start = 13, stop = 13)
> cat(pm[1], mm[1], sep = "\n")
TCTCCTTTGCTGAGGCCTCCAGCTT
TCTCCTTTGCTGTGGCCTCCAGCTT



On Thu, 10 Feb 2005, Hrishikesh Deshmukh wrote:

> Hi All,
> 
> I am posting this question since i didn't find
> satisfactory response on the searching the mailing
> lists.
> I want mismatch sequences for a chip say human
> (95/133).
> Is there a nifty function which can be easily applied
> on the entire chip and outputs mismatch sequences in
> the same format as PM sequences!
> 
> Any pointers/ideas?!
> 
> Thanks,
> Hrishi
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
>