[BioC] (x,y) coordinates and probe intensity

[James W. MacDonald]

Ashley Lin wrote:
> Dear group,
> 
> I know this issue has been discussed before, but I had a hard time 
> figuring out how to associate the intensity of a probe in CEL file with 
> the x, y coordinates of the probes in the chip.
> 
> For example, in Affymetrix U133A chip, the first probe is:
> 
>> probe:HG-U133A_2:1007_s_at:416:177; Interrogation_Position=3330; 
>> Antisense;
> 
> CACCCAGCTGGTCCTGTGGATGGGA
> 
> where 416 is x coordinate and 177 is y coordinate on the chip.
> 
> But when I use the following command,
> 
>> cel<-ReadAffy() # there is only one CELfile in the folder
>> pmindex(cel)[1]
> 
> 
> I got the location information of the probe set 1007_s_at :
> 
> $"1007_s_at"
> [1] 129340 213420 396671  82246 430968 427082 432610  72465 432865  99501
> [11] 504952 443862 341432 198778 463575  10989

The problem here is that you are looking at the hgu133a2probe package 
(designed for the HG-U133A version 2 chip), but comparing to data from 
the HG-U133A chip. If you look at data from the correct probe package 
you get:

 > as.data.frame(hgu133aprobe)[1,]
                    sequence   x   y Probe.Set.Name 
Probe.Interrogation.Position
1 CACCCAGCTGGTCCTGTGGATGGGA 467 181      1007_s_at

and using the correct xy2i function, I get

 > xy2i(467, 181)
[1] 129340


Best,

Jim




> 
> But none of the following equations that mentioned in the list before 
> can fit into these numbers
> 
>> (Textual description of makecdfenv): j = x*nrow + y + 1
>> (Textual description of affy, p.26): j = x*nrow y + 1 (sic!) j = 
>> Probe.Y * nrow + Probe.X + 1 (for the perfect match)
>> jmm = Probe.Y * nrow + Probe.X + 2 (for the mismatch)
> 
> 
> Does nrow refer to the row number of the batch file? Here 
> ncol(intensity(cel))=1, nrow(intensity(cel))=506944
> 
> Can anybody tell me how this works please?
> 
> Thank you very much,
> Ashley
> 
> _________________________________________________________________
> Don’t just search. Find. Check out the new MSN Search!
> 
> 
> ------------------------------------------------------------------------
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor


-- 
James W. MacDonald
Affymetrix and cDNA Microarray Core
University of Michigan Cancer Center
1500 E. Medical Center Drive
7410 CCGC
Ann Arbor MI 48109
734-647-5623