[BioC] xy2i in SNps...

[Mayte Suarez-Farinas]

Hi,

I know it have been a lot of questions about the xy2i function in the 
mailing list, but I could not find my answer, so I am writting to
ask your help.

I am working with SNPs chips, speciffically, the 10K. I made the CDF 
packages and read the CEL files with ReadAffy function. While trying to 
read the sequence information in the CDF files, and crosschecking with the 
affy object, I got the following result:

index<-indexProbes(my.snp,which='both')
i<-index[['SNP_A-1513509A']]
cbind(i2xy(i),i)

        x   y      i
  [1,] 257 307 202264 *****
  [2,] 403 433 285318 *****
  [3,] 528 237 156475
  [4,] 586 453 298661
  [5,]  73 393 258668
  [6,] 594 359 236817
  [7,] 435 473 311670
  [8,] 254 349 229897
  [9,] 529 399 263072
[10,] 358 529 348441
[11,] 257 308 202922 ******
[12,] 403 434 285976 ******
[13,] 528 238 157133
[14,] 586 454 299319
[15,]  73 394 259326
[16,] 594 360 237475
[17,] 435 474 312328
[18,] 254 350 230555
[19,] 529 400 263730
[20,] 358 530 349099

But in the CDF file, the information for SNP_A-1513509A is: (I include 
only 4 probes )

Cell1=257   308   CTTTGTAAAACGCTGATAGAAGAAT   SNP_A-1513509A	202921 
Cell2=257   307   CTTTGTAAAACGGTGATAGAAGAAT   SNP_A-1513509A	202263 
Cell3=403   434   TTGTAAAACGGTCATAGAAGAATCC   SNP_A-1513509A    285975 
Cell4=403   433	  TTGTAAAACGGTGATAGAAGAATCC   SNP_A-1513509A	285317


The result is the same if I use the fucntion indices2xy(i,abatch=my.snp,xy.offset=0)
and the following if I considered xy.offset=1. But none of them coincide 
with the CDF.

      x   y      i
  [1,] 258 308 202264
  [2,] 404 434 285318
  [3,] 529 238 156475
  [4,] 587 454 298661
  [5,]  74 394 258668
  [6,] 595 360 236817
  [7,] 436 474 311670
  [8,] 255 350 229897
  [9,] 530 400 263072
[10,] 359 530 348441
[11,] 258 309 202922
[12,] 404 435 285976
[13,] 529 239 157133
[14,] 587 455 299319
[15,]  74 395 259326
[16,] 595 361 237475
[17,] 436 475 312328
[18,] 255 351 230555
[19,] 530 401 263730
[20,] 359 531 349099

So, I don't know if the SNPs handle the index and position in a diferent 
manner or something else.
Any help will be welcome!
Thanks in advance!!!
Mayte

------------------------
Mayte Suarez-Farinas
The Rockefeller University
1230 York Avenue, Box 212
New York, NY 10021
phone: 1-212-327-8186
fax:   1-212-327-7422