[BioC] affy, probeName and sequence information ?

[Laurent Gautier]

For this kind of stuff, 'indexProbes' might be more convenient.

Ex:
i.pm <- indexProbes(af, "1007_s_at", "pm")[[1]]

xy.pm <- indices2xy(i.pm, abatch=af)

## note the '+1'. The Affymetrix coordinates start at 0 while they start at 1
## in the affy package
seq.pm <- (xy.pm[,1] == theProbeSet$POSITIONX + 1) & (xy.pm[,2] == theProbeSet$POSITIONY + 1)


Hopin' it helps,


L.

 
On Mon, Sep 15, 2003 at 09:25:26AM +0200, laurent  buffat wrote:
> 
> Hi all,
> 
> With the affy package, I can have the signal(pm or mm) for all the probe for
> one probeSet.
> For example (if my affbatch "af" is from two HU133A .CEL)
> 
> > pm(af,"1007_s_at")
> 
>              a1    a2
> 1007_s_at1	713.0 575.3
> 1007_s_at2  ...
> ...
> 1007_s_at16 ...   ....
> 
> On an other hand, I can have the sequence and the position for the
> differents probe of a given probe set :
> 
>  POG    TARGET                  RESIDUES POSITIONX POSITIONY
> 1  3330 1007_s_at CACCCAGCTGGTCCTGTGGATGGGA       467       181
> 2  3443 1007_s_at GCCCCACTGGACAACACTGATTCCT       531       299
> 3  3512 1007_s_at TGGACCCCACTGGCTGAGAATCTGG        86       557
> 4  3563 1007_s_at AAATGTTTCCTTGTGCCTGCTCCTG       365       115
> ...
> 16 3878 1007_s_at ATATATGGACCTAGCTTGAGGCAAT       308        15
> 
> and my problem is how I can link the "probename" (1007_s_at1) to the
> corresponding sequence ?. The sequence of 1007_s_at1 is "CACC..." or
> "GCCC.." or etc... ?
> Is there a available relation between the "number" of the probe in the Affy
> package and the position ?
> 
> Tanks for your help.
> 
> L. buffat
> 
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://www.stat.math.ethz.ch/mailman/listinfo/bioconductor

-- 
--------------------------------------------------------------
Laurent Gautier			CBS, Building 208, DTU
PhD. Student			DK-2800 Lyngby,Denmark	
tel: +45 45 25 24 89		http://www.cbs.dtu.dk/laurent