[Bioc-sig-seq] first remove low quality or adaptor

[Hervé Pagès]

On 11-09-20 06:33 PM, wang peter wrote:
> i think remove low quality is better
> because the low quality position on the 3' end will lead to many mismatch.
> so you could not set the parameter of mismatch well
>
> after remove low quality 3' end, it is easy for good match between 3' end
> with adaptor
>
> but i met another problem, when i trimmed the adaptor on the data without
> low quality 3' end
>
> the lenght of reads are not uniform, the max is 40
> when i use a 40 long adaptor
> PCR2<- DNAString("AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAACAA")
>> a<-trimLRPatterns(Rpattern = PCR2, subject = seqs, max.Rmismatch=0.1,
> with.Rindels=T)
> Error in solveUserSEW(width(x), start = start, end = end, width = width) :
>    solving row 2934: 'allow.nonnarrowing' is FALSE and the supplied start (0)
> is<  1

Can you please show me seqs[[2934]] so I can try to reproduce?

Also, because you provide 2 different sessionInfo(), it's not
clear which version of R you are using, 2.13.1 or 2.11.1?

Thanks,
H.

>
> i think maybe it is due to many read lenght is below than 40
> but when i run this on linux, it is ok
>
> the r version:
>
> sessionInfo()
> R version 2.13.1 (2011-07-08)
> Platform: x86_64-pc-mingw32/x64 (64-bit)
> sessionInfo()
> R version 2.11.1 (2010-05-31)
> x86_64-unknown-linux-gnu
>
> 	[[alternative HTML version deleted]]
>
> _______________________________________________
> Bioc-sig-sequencing mailing list
> Bioc-sig-sequencing at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing


-- 
Hervé Pagès

Program in Computational Biology
Division of Public Health Sciences
Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N, M1-B514
P.O. Box 19024
Seattle, WA 98109-1024

E-mail: hpages at fhcrc.org
Phone:  (206) 667-5791
Fax:    (206) 667-1319