[R] codon usage bias
    R. Michael Weylandt <michael.weylandt@gmail.com> 
    michael.weylandt at gmail.com
       
    Wed Feb 29 17:37:17 CET 2012
    
    
  
This question sounds more suited for the Bioconductor list which focuses on R tools for genetic/bioinformatic computation. It's an active and very friendly list and I think one doesn't have to subscribe to post (but doing so certainly isn't a bad idea).
Michael
On Feb 29, 2012, at 9:55 AM, aoife <aoife.m.doherty at gmail.com> wrote:
> Hey guys, I have what i think is a really simple problem :(
> 
> I installed the seqinr library. I want to do an RSCU analysis.
> 
> But i can't get it to work in even the simplest case. for example, if i have
> a string read in:
> 
>> newdata5
> $testseq
> [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
> 
> 
> and then i perform an RSCU analysis on it...
> 
> 
>> uco(newdata5,index="rscu")
> aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag
> cat 
> NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA 
> NA 
> cca ccc ccg cct cga cgc cgg cgt cta ctc ctg ctt gaa gac gag gat gca gcc gcg
> gct 
> NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA 
> NA 
> gga ggc ggg ggt gta gtc gtg gtt taa tac tag tat tca tcc tcg tct tga tgc tgg
> tgt 
> NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA 
> NA 
> tta ttc ttg ttt 
> NA  NA  NA  NA 
> 
> 
> it's telling me that there are no codons. I'm not sure how to split up the
> data or make this work at all.
> Any help appreciated.
> 
> Aoife
> 
> 
> --
> View this message in context: http://r.789695.n4.nabble.com/codon-usage-bias-tp4431740p4431740.html
> Sent from the R help mailing list archive at Nabble.com.
> 
> ______________________________________________
> R-help at r-project.org mailing list
> https://stat.ethz.ch/mailman/listinfo/r-help
> PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
> and provide commented, minimal, self-contained, reproducible code.
    
    
More information about the R-help
mailing list