[R] merging nexus sequence files

[nikki22]

Hi, newbie here,

I was wondering if anyone can out, I have checked through the help archives
but cannot find my answer.

I have three nexus files mostly with the same taxa but some are different. I
want to concatenate the DNA sequences from these three files into one large
nexus file but I cannot seem to accomplish it!

This is an example:

file1
taxon1 aaggttcc
taxon2 aagtttcg
taxon3 aaggttcc

file2
taxon2 ctgctg
taxon3 ctggtc
taxon4 ctgctg

file3
taxon1 ggttggtta
taxon2 ggttggttc
taxon4 ggttggttc

this is what i want to end up with (where ? means missing data) in nexus
format:

taxon1 aaggttcc??????ggttggtta
taxon2 aagtttcgctgctgggttggttc
taxon3 aaggttccctggtc????????
taxon4 ??????????????ggttggttc

Thanks in advance for any help!


--
View this message in context: http://r.789695.n4.nabble.com/merging-nexus-sequence-files-tp3816907p3816907.html
Sent from the R help mailing list archive at Nabble.com.