[R] read a text file with variable number of spaces

[Gerrit Eichner]

Hello, Gregory,

for your first data set see

?read.table

and for you second

?read.fwf

may help solving your problem.

Hth  --  Gerrit


On Thu, 3 Mar 2011, Gregory Ryslik wrote:

> Hi,
>
>
> I seem to be having somewhat of an unusual data input problem with some 
> of the data sets I'm working with and want to run a simulation on.
>
> in the first data set I'm looking at, I have a text file where the 
> spacing between columns varies. I've attached a snippet. Is there a way 
> to read this into R? Basically, I want to ignore all the spaces to make 
> new columns. In a slightly different case, I have a long sequence of 
> nucleotides (the letters are always either g,a,t,c). Is there a way to 
> get each letter into it's own column so that I can then use it as a data 
> set?
>
> I'm kind of loathe to program a java/C program to do this if I don't 
> have to and was wondering if a way in R exists for this.
>
> Thanks!
> Greg
>
> Case1:
> ACE2_YEAST  0.42  0.37  0.59  0.20  0.50  0.00  0.52  0.29  NUC
> ACH1_YEAST  0.40  0.42  0.57  0.35  0.50  0.00  0.53  0.25  CYT
> ACON_YEAST  0.60  0.40  0.52  0.46  0.50  0.00  0.53  0.22  MIT
> ACR1_YEAST  0.66  0.55  0.45  0.19  0.50  0.00  0.46  0.22  MIT
> ACT_YEAST   0.46  0.44  0.52  0.11  0.50  0.00  0.50  0.22  CYT
> ACT2_YEAST  0.47  0.39  0.50  0.11  0.50  0.00  0.49  0.40  CYT
> ACT3_YEAST  0.58  0.47  0.54  0.11  0.50  0.00  0.51  0.26  NUC
> ACT5_YEAST  0.50  0.34  0.55  0.21  0.50  0.00  0.49  0.22  NUC
>
> Case2:
> gtacagtacgtacgtacgatcgatctagcatgcatgcatgcatgcta
> ______________________________________________
> R-help at r-project.org mailing list
> https://stat.ethz.ch/mailman/listinfo/r-help
> PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
> and provide commented, minimal, self-contained, reproducible code.