[R] reading a string vector

[Henrique Dallazuanna]

Try this:

strsplit("atgctaaaactaatcgtcccaacaattatattactaccac", NULL)

On Tue, Jan 26, 2010 at 11:08 AM, bia.estat <bia.cdc at live.com> wrote:
>
> Hi, I need to read a string vector in R which is like this
> "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as
> a unique vector input when I read in like x <-
> "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
> can use each of the letters on my reading?
>
> Thanks,
> Beatriz
> --
> View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1290289.html
> Sent from the R help mailing list archive at Nabble.com.
>
>        [[alternative HTML version deleted]]
>
> ______________________________________________
> R-help at r-project.org mailing list
> https://stat.ethz.ch/mailman/listinfo/r-help
> PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
> and provide commented, minimal, self-contained, reproducible code.
>



-- 
Henrique Dallazuanna
Curitiba-Paraná-Brasil
25° 25' 40" S 49° 16' 22" O