[R] reading a string vector

[Romain Francois]

On 01/26/2010 02:08 PM, bia.estat wrote:
> Hi, I need to read a string vector in R which is like this
> "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as
> a unique vector input when I read in like x<-
> "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
> can use each of the letters on my reading?
>
> Thanks,
> Beatriz

See ?strsplit

 > strsplit( x, "")[[1]]

Romain

-- 
Romain Francois
Professional R Enthusiast
+33(0) 6 28 91 30 30
http://romainfrancois.blog.free.fr
|- http://tr.im/KfKn : Rcpp 0.7.2
|- http://tr.im/JOlc : External pointers with Rcpp
`- http://tr.im/JFqa : R Journal, Volume 1/2, December 2009