Dear BioC,

I am trying to handle low level data information from affymetrix gene chips.
what I want to do is to redesign cdf files according to my peculiar experiment.

the point is that I download from affymetrix website the information regarding all the probes; 
after data analysis I would like to convert the information that are provided with the fasta files to the index available in library files such as the one "hgu133acdf"

now if explore the fasta files from affymetrix I retrieve this information:
>probe:HG-U133A:1007_s_at:467:181; Interrogation_Position=3330; Antisense;
CACCCAGCTGGTCCTGTGGATGGGA
>probe:HG-U133A:1007_s_at:531:299; Interrogation_Position=3443; Antisense;
GCCCCACTGGACAACACTGATTCCT
>probe:HG-U133A:1007_s_at:86:557; Interrogation_Position=3512; Antisense;
TGGACCCCACTGGCTGAGAATCTGG
>probe:HG-U133A:1007_s_at:365:115; Interrogation_Position=3563; Antisense;
AAATGTTTCCTTGTGCCTGCTCCTG
>probe:HG-U133A:1007_s_at:207:605; Interrogation_Position=3570; Antisense;
TCCTTGTGCCTGCTCCTGTACTTGT
>probe:HG-U133A:1007_s_at:593:599; Interrogation_Position=3576; Antisense;
TGCCTGCTCCTGTACTTGTCCTCAG
>probe:HG-U133A:1007_s_at:425:607; Interrogation_Position=3583; Antisense;
TCCTGTACTTGTCCTCAGCTTGGGC

however if I ask to the package "hgu133acdf" the index corresponding to the probes 1007_s_at

I obtain 

> exSet
          pm     mm
 [1,] 129340 130052
 [2,] 213420 214132
 [3,] 396671 397383
 [4,]  82246  82958
 [5,] 430968 431680
 [6,] 427082 427794
 [7,] 432610 433322
 [8,]  72465  73177
 [9,] 432865 433577
[10,]  99501 100213
[11,] 504952 505664
[12,] 443862 444574
[13,] 341432 342144
[14,] 198778 199490
[15,] 463575 464287
[16,]  10989  11701

even if I apply xy2indeces I could not find any correspondence.

pleas could you help me and tell me where I am wrong?

--
Claudio Isella







	[[alternative HTML version deleted]]