Hi,

Sorry for this basic question - I'm new to BLAST!

I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a sequence with the rhesus organism. I would like to get the following values:

1. Score (bits)
2. E-value
3. # Matches


I am trying to use the 'annotate' package with the following code:

library(annotate)
xx <- blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn")


Can (how?) I get the values that I want from the object returned? If not, which package/function should I be using? Also, is there a website where I can get the abbreviations for the databases (e.g. is rhesus = 'rh'?)?

Any pointers in the right direction would be highly appreciated


many thanks
	[[alternative HTML version deleted]]