Hi Jim, Thanks for the reply. I can get it to work even with the 2 without the quotes. But how do I get the values that I want (E-value, mismatches etc.) from the object returned by blastSequences?  many thanks! ________________________________ From: James W. MacDonald Cc: bioc Sent: Friday, August 31, 2012 3:09 PM Subject: Re: [BioC] BLAST - annotate package? Hi Tim, Try changing the hitListSize to character: > blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize="2") [[1]] DNAMultipleAlignment with 2 rows and 36 columns       aln [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [[2]] DNAMultipleAlignment with 2 rows and 36 columns       aln [1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT [2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT Best, Jim On 8/31/2012 2:44 PM, Tim Smith wrote: > Hi, > [[elided Yahoo spam]] > > I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a sequence with the rhesus organism. I would like to get the following values: > > 1. Score (bits) > 2. E-value > 3. # Matches > > > I am trying to use the 'annotate' package with the following code: > > library(annotate) > xx<- blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn") > > > Can (how?) I get the values that I want from the object returned? If not, which package/function should I be using? Also, is there a website where I can get the abbreviations for the databases (e.g. is rhesus = 'rh'?)? > > Any pointers in the right direction would be highly appreciated > > > many thanks >     [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician University of Washington Environmental and Occupational Health Sciences 4225 Roosevelt Way NE, # 100 Seattle WA 98105-6099 [[alternative HTML version deleted]]