Hi James,

It would be worthwhile to provide a reproducible piece of code that
generates an error; this way the folks who maintain the package will have a
better position to fix things. Otherwise, only reporting that you have
problems with the software makes it entirely inefficient for the
maintainers.

Cheers,
--tony

On Thu, May 28, 2009 at 2:00 PM, James Bullard <bullard@berkeley.edu> wrote:

> Hi, I am having problems with biomaRt and based on Wolfgang's post it looks
> like I shouldn't be (or am I being completely naive?):
>
> Thanks, jim
>
> > library("biomaRt")
> > mart = useMart("ensembl")
> > ensembl = useDataset("hsapiens_gene_ensembl",
> +    mart=mart)
> Checking attributes ... ok
> Checking filters ... ok
> > EGsub = c("1635_at"="25", "39329_at"="87", "40797_at"="102")
> > utr = getSequence(id=EGsub, seqType="3utr",
> +    mart=ensembl, type="entrezgene")
> CA ..... I cut out a lot of the sequence ...
> GTGCCCTGCCTTGCACCTCCGCCTTATTTTCTGC      87
>                                                         V1
> 1                                           HTTP/1.1 200 OK
> 2                       Date: Thu, 28 May 2009 20:56:08 GMT
> 3 Server: Apache/2.2.9 (Debian) mod_perl/2.0.4 Perl/v5.10.0
> 4                                         Connection: close
> 5                                Transfer-Encoding: chunked
> 6                                  Content-Type: text/plain
> Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,
>  :
>  The query to the BioMart webservice returned an invalid result: the number
> of columns in the result table does not equal the number of attributes in
> the query. Please report this to the mailing list.
> > sessionInfo()
> R version 2.9.0 Patched (2009-05-28 r48678)
> x86_64-unknown-linux-gnu
>
> locale:
>
> LC_CTYPE=en_US.UTF-8;LC_NUMERIC=C;LC_TIME=en_US.UTF-8;LC_COLLATE=en_US.UTF-8;LC_MONETARY=C;LC_MESSAGES=en_US.UTF-8;LC_PAPER=en_US.UTF-8;LC_NAME=C;LC_ADDRESS=C;LC_TELEPHONE=C;LC_MEASUREMENT=en_US.UTF-8;LC_IDENTIFICATION=C
>
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods   base
>
> other attached packages:
> [1] biomaRt_2.0.0
>
> loaded via a namespace (and not attached):
> [1] RCurl_0.95-1 tools_2.9.0  XML_2.3-0
>
>
>
> On May 28, 2009, at 5:01 AM, Wolfgang Huber wrote:
>
>  Hi
>>
>> just to warn all users of the development version of biomaRt, please wait
>> a few days before updating your RCurl, the current devel versions of these
>> two packages do not work together. We are sorting it out.
>>
>> An example for the error that is produced, with RCurl_0.97-2 and
>> biomaRt_2.1.0, is shown below. With a previous version of RCurl, the problem
>> should not arise.
>>
>>
>> library("biomaRt")
>> mart = useMart("ensembl")
>> ensembl = useDataset("hsapiens_gene_ensembl",
>>   mart=mart)
>> EGsub = c("1635_at"="25", "39329_at"="87", "40797_at"="102")
>> utr = getSequence(id=EGsub, seqType="3utr",
>>   mart=ensembl, type="entrezgene")
>>
>> CAGCAGTCAGGGGTCAGGTGTCAGGCCCGTCGGAGCT...   25
>> CTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAA...  102
>> TCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTG...   87
>> TCCACCCCGCCCGGCCGCCCTCGTCTTGTGCGCCGTG...   87
>>                                                        V1
>> 1                                           HTTP/1.1 200 OK
>> 2                       Date: Thu, 28 May 2009 11:57:58 GMT
>> 3 Server: Apache/2.2.9 (Debian) mod_perl/2.0.4 Perl/v5.10.0
>> 4                                         Connection: close
>> 5                                Transfer-Encoding: chunked
>> 6                                  Content-Type: text/plain
>>
>> Errore in getBM(c(seqType, type), filters = type, values = id, mart =
>> mart,  :
>>  The query to the BioMart webservice returned an invalid result: the
>> number of columns in the result table does not equal the number of
>> attributes in the query. Please report this to the mailing list.
>>
>>
>> > sessionInfo()
>> R version 2.10.0 Under development (unstable) (2009-05-28 r48665)
>> x86_64-unknown-linux-gnu
>>
>> locale:
>> [1] LC_CTYPE=C              LC_NUMERIC=C            LC_TIME=C
>> [4] LC_COLLATE=C            LC_MONETARY=C LC_MESSAGES=it_IT.UTF-8
>> [7] LC_PAPER=C              LC_NAME=C               LC_ADDRESS=C
>> [10] LC_TELEPHONE=C          LC_MEASUREMENT=C        LC_IDENTIFICATION=C
>>
>> attached base packages:
>> [1] stats     graphics  grDevices datasets  utils     methods   base
>>
>> other attached packages:
>> [1] biomaRt_2.1.0  fortunes_1.3-6
>>
>> loaded via a namespace (and not attached):
>> [1] RCurl_0.97-2 XML_2.3-0
>> >
>>
>>
>> --
>>
>> Best wishes
>>    Wolfgang
>>
>> ------------------------------------------------
>> Wolfgang Huber, EMBL, http://www.ebi.ac.uk/huber
>>
>> _______________________________________________
>> Bioconductor mailing list
>> Bioconductor@stat.math.ethz.ch
>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>> Search the archives:
>> http://news.gmane.org/gmane.science.biology.informatics.conductor
>>
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor@stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
> http://news.gmane.org/gmane.science.biology.informatics.conductor
>

	[[alternative HTML version deleted]]