Hello all, I came across an apparent discrepancy in the x,y values in the canineprobe package as compared to the caninecdf file (both downloaded from Bioconductor with the last 2 months) . For many probesets, the order of the probes seems to have shifted. For example, for probeset 1592123_at: > pmi <- indexProbes(raw,which="pm",genenames="1592123_at")[[1]] > indices2xy(pmi,abatch=raw) x y [1,] 565 347 [2,] 5 41 [3,] 331 327 [4,] 521 357 [5,] 542 363 [6,] 403 601 [7,] 314 283 [8,] 135 665 [9,] 5 679 [10,] 33 647 [11,] 619 181 Compare this with the linear order of the probes as given by the canineprobe package: > xylist = as.data.frame(canineprobe) > xylist[107231:107241,1:4] sequence x y Probe.Set.Name 107231 GAACGCCCAGATGCGTGAAAATGGA 542 363 1592123_at 107232 TGAAAATGGAAGAGGAACTTTGCCG 403 601 1592123_at 107233 CGAAGCTTGCTAACTACCAAAGACA 314 283 1592123_at 107234 TACCAAAGACACTTATTGGCCGCCT 135 665 1592123_at 107235 GAGTCAAAATGAAGTTCCGGAAGAC 565 347 1592123_at 107236 TATCAACGAAACTTAGCTTGCCCAG 5 679 1592123_at 107237 TCAACGAAACTTAGCTTGCCCAGAT 33 647 1592123_at 107238 AACGAAACTTAGCTTGCCCAGATTC 619 181 1592123_at 107239 ATGAAGTTCCGGAAGACAGGGTGCA 5 41 1592123_at 107240 GTTCCGGAAGACAGGGTGCAGTCCC 331 327 1592123_at 107241 GAAGACAGGGTGCAGTCCCTCCCCT 521 357 1592123_at However, other genes have the same order of their probes: > pmi2 <- indexProbes(raw,which="pm",genenames="1582358_s_at")[[1]] > indices2xy(pmi2,abatch=raw) x y [1,] 721 81 [2,] 575 41 [3,] 421 179 [4,] 188 269 [5,] 459 647 [6,] 538 197 [7,] 217 441 [8,] 448 121 [9,] 27 37 [10,] 683 389 [11,] 198 255 > xylist[507:517,1:4] sequence x y Probe.Set.Name 507 AGTATGACAACTCCCTCAAGATTGT 721 81 1582358_s_at 508 ATGACAACTCCCTCAAGATTGTCAG 575 41 1582358_s_at 509 AACTCCCTCAAGATTGTCAGCAATG 421 179 1582358_s_at 510 CTCCCTCAAGATTGTCAGCAATGCC 188 269 1582358_s_at 511 TCAAGATTGTCAGCAATGCCTCCTG 459 647 1582358_s_at 512 AAGATTGTCAGCAATGCCTCCTGCA 538 197 1582358_s_at 513 GATTGTCAGCAATGCCTCCTGCACC 217 441 1582358_s_at 514 ACCACCAACTGCTTGGCTCCTCTAG 448 121 1582358_s_at 515 ATCCATGACCACTTCGGCATCGTGG 27 37 1582358_s_at 516 GACCACTTCGGCATCGTGGAGGGCC 683 389 1582358_s_at 517 CTTCGGCATCGTGGAGGGCCTCATG 198 255 1582358_s_at The discrepancy seems to be wide-spread. The actual order of the probesets themselves is different (1582358_s_at is the first probeset in the affybatch, but it starts at row 507 in the xylist from the canineprobe). Is it possible that the linear order is not really the probe number order, and the actual probe numbers can be gotten for each x,y coordinate? I tried the same sorts of things with the rat2302cdf and rat2302probe packages, but there are no discrepancies between probe orders, which made me think it was a problem with the canineprobe package itself. I'd appreciate any and all help on this matter... Thanks, Jenny Jenny Drnevich, Ph.D. Functional Genomics Bioinformatics Specialist W.M. Keck Center for Comparative and Functional Genomics Roy J. Carver Biotechnology Center University of Illinois, Urbana-Champaign 330 ERML 1201 W. Gregory Dr. Urbana, IL 61801 USA ph: 217-244-7355 fax: 217-265-5066 e-mail: drnevich@uiuc.edu [[alternative HTML version deleted]]