[BioC] Problem with biomaRt::getSequence.

[Sean Davis]

On Tue, May 7, 2013 at 6:54 AM, Tanvir Ahamed [guest]
<guest at bioconductor.org> wrote:
>
> Hi,
> I can run the code some days ago . But cant run now.
>
> Problem 1: Output is ok
> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
> utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl)
> Output :
>                                                                                               5utr  entrezgene
>                                                                              Sequence unavailable      10644
>                                              GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
> 3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>                                  CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>                                                          No UTR is annotated for this transcript      10644
>
> Problem 2:Problem is here
> protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)
>
> Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  :
>   Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)

This is most likely a problem on the machine that is running the
biomart (presumably Ensembl).  I suspect that they'll pick up on this
by themselves, so try your query in a little bit to see if the problem
has been fixed.  If it is not resolved, I'd suggesting writing to the
biomart folks at ensembl.  I do not think this is something you are
doing wrong or that there is anything you can do yourself to fix it.

Sean


> I need help please.
>
>
>  -- output of sessionInfo():
>
> R version 3.0.0 (2013-04-03)
> Platform: x86_64-w64-mingw32/x64 (64-bit)
>
> locale:
> [1] LC_COLLATE=Bangla_Bangladesh.1252  LC_CTYPE=Bangla_Bangladesh.1252    LC_MONETARY=Bangla_Bangladesh.1252 LC_NUMERIC=C
> [5] LC_TIME=Bangla_Bangladesh.1252
>
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods   base
>
> other attached packages:
> [1] seqinr_3.0-7   biomaRt_2.16.0
>
> loaded via a namespace (and not attached):
> [1] RCurl_1.95-4.1 tools_3.0.0    XML_3.96-1.1
>
> --
> Sent via the guest posting facility at bioconductor.org.
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor