[BioC] matchPattern vmatchPattern vectorised

[Steve Lianoglou]

Hi,

On Sat, Dec 14, 2013 at 6:00 AM, Stephen [guest] <guest at bioconductor.org> wrote:
>
> Hi
> I am trying to write a package that will make a few shortcuts for my lazy coworkers. So I wrote a few bits of code that will find their primers in amongst a fastq of multiplexed reads (e.g 10-20).
>
> Next I thought I would save them the trouble of copy pasting Primers, Chromosome, and Start into a shell script, by instead autogenerating the script - We have the excellent BSgenome and Mmusculus9 packages installed so this seems a good starting point:
>
> So for the first primer this works well:
>> system.time(vmatchPattern("CCAGCACTGTATAGCCGATC", Mmusculus))
>    user  system elapsed
>  45.853   2.702  50.273
>
> This is fine for a single primer but it seems from the docs (and testing) that if I want to lookup 15 primers it will take 15 passes through the genome and 15x as long. About the same time it would take them to just copy them from their lab-books. I guess they could have a coffee...still...
>
> My first question: Is there another function or package on BioC that I have missed that might help me with this? Or low level functions I should look at to build a vectorised search (exact match) through Mmusculus?

There are packages which wrap aligners that you might consider using:

* gmapR
  http://bioconductor.org/packages/release/bioc/html/gmapR.html

* Rsubread:
  http://bioconductor.org/packages/release/bioc/html/Rsubread.html

HTH,
-steve

-- 
Steve Lianoglou
Computational Biologist
Genentech