[BioC] Annotate blastSequences Returns No Result

[Dario Strbenac]

Hello,

The function blastSequences in the package Annotate isn't returning anything for the following example, a sequence from the beginning of GAPDH in the human genome reference sequence.

> blastSequences("TGGGACTGGCTGAGCCTGGCGGGAGGCGGGGTCCGAGTCACCGCCTGCCGCCGCGCCCCCGGTTTCTATAAATTGAGC", "nr/nt")
list()

I think my issue is I don't understand the format of the database argument, because I can provide nonsense names for the database, and it doesn't give an error for those. The help file doesn't contain enough detail. Can the documentation be clarified ?

I am also interested in the argument "filter" for which there is only a blank space.

--------------------------------------
Dario Strbenac
PhD Student
University of Sydney
Camperdown NSW 2050
Australia