[BioC] cdf redesign

[James W. MacDonald]

Hi Claudio,

On 8/1/2013 10:25 AM, Claudio Isella wrote:
> Dear BioC,
>
> I am trying to handle low level data information from affymetrix gene chips.
> what I want to do is to redesign cdf files according to my peculiar experiment.
>
> the point is that I download from affymetrix website the information regarding all the probes;
> after data analysis I would like to convert the information that are provided with the fasta files to the index available in library files such as the one "hgu133acdf"
>
> now if explore the fasta files from affymetrix I retrieve this information:
>> probe:HG-U133A:1007_s_at:467:181; Interrogation_Position=3330; Antisense;
> CACCCAGCTGGTCCTGTGGATGGGA
>> probe:HG-U133A:1007_s_at:531:299; Interrogation_Position=3443; Antisense;
> GCCCCACTGGACAACACTGATTCCT
>> probe:HG-U133A:1007_s_at:86:557; Interrogation_Position=3512; Antisense;
> TGGACCCCACTGGCTGAGAATCTGG
>> probe:HG-U133A:1007_s_at:365:115; Interrogation_Position=3563; Antisense;
> AAATGTTTCCTTGTGCCTGCTCCTG
>> probe:HG-U133A:1007_s_at:207:605; Interrogation_Position=3570; Antisense;
> TCCTTGTGCCTGCTCCTGTACTTGT
>> probe:HG-U133A:1007_s_at:593:599; Interrogation_Position=3576; Antisense;
> TGCCTGCTCCTGTACTTGTCCTCAG
>> probe:HG-U133A:1007_s_at:425:607; Interrogation_Position=3583; Antisense;
> TCCTGTACTTGTCCTCAGCTTGGGC
>
> however if I ask to the package "hgu133acdf" the index corresponding to the probes 1007_s_at
>
> I obtain
>
>> exSet
>            pm     mm
>   [1,] 129340 130052
>   [2,] 213420 214132
>   [3,] 396671 397383
>   [4,]  82246  82958
>   [5,] 430968 431680
>   [6,] 427082 427794
>   [7,] 432610 433322
>   [8,]  72465  73177
>   [9,] 432865 433577
> [10,]  99501 100213
> [11,] 504952 505664
> [12,] 443862 444574
> [13,] 341432 342144
> [14,] 198778 199490
> [15,] 463575 464287
> [16,]  10989  11701
>
> even if I apply xy2indeces I could not find any correspondence.
>
> pleas could you help me and tell me where I am wrong?

You don't show what you have done, so nobody can tell you where you went 
wrong. I do get the expected data using indices2xy, however:

 > indices2xy(get("1007_s_at", hgu133acdf)[,1], cdf="hgu133acdf")
x y
[1,] 467 181
[2,] 531 299
[3,] 86 557
[4,] 365 115
[5,] 207 605
[6,] 593 599
[7,] 425 607
[8,] 552 101
[9,] 680 607
[10,] 532 139
[11,] 143 709
[12,] 285 623
[13,] 383 479
[14,] 129 279
[15,] 62 651
[16,] 308 15

Best,

Jim



Best,

Jim


>
> --
> Claudio Isella
>
>
>
>
>
>
>
> 	[[alternative HTML version deleted]]
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor

-- 
James W. MacDonald, M.S.
Biostatistician
University of Washington
Environmental and Occupational Health Sciences
4225 Roosevelt Way NE, # 100
Seattle WA 98105-6099